aut disce aut discedere

a......ha...

2010-09-21T05:56:00.001-07:00

no, not a totally awesome concert. a realization, an epiphany, if you would;

why has Marit's face been flipping out for the past week, getting progressively worse after being quiet for months?

the puppy has been getting antibiotics for the past week. penicillin based antibiotics. oh. yeah. what is Marit allergic to? penicillin, you say? hmmm...

this, of course, assumes that i'll react to a penicillin through my skin. if not, back to a very annoying square one.

zoooommmbbbiiiieeeee...

2010-08-22T15:53:00.001-07:00

'cause that's apparently what I am, having not blogged since March. you know. you blink, five months go by. eh.

So. five months, huh.

this is pretty much one of the best things ever.
Bought a Nook for my birthday. pretty sweet. only gripes so far are the occasional horrible conversion (I'm looking at you, Winds of Change.) and the fact that a good half of the books I wanted to get in ebook form are not currently available. why I thought an out of print book would be easily findable as an ebook, I'm not sure. not really the Nook's fault. Also, cashy money can disappear quite rapidly, which is not good. But they have a free book pretty much every week, which is great, but I'd really love for more of them not to be porn. wait, sorry- 'romance.' no, no, I stand by my earlier statement. porn. at the very least can I get some better written pr0nmances? for instance, if you're going to write about races of hunky greek gods and impending supernatural wars and your mild-mannered bookseller/child-of-prophecy/strip club server...research is your friend. so is a higher plot-to-porn ratio. I finished reading you because you were free and really, you have to be stunningly, amazingly, incredibly bad before I'll put you down unread. Banshee book, you were better. (also, less porn. coincidence?)

um...

I had a whole bunch of cranky ems-related posts of the "Tips for Nurses, Patients, and Family Members" "Dispatch, I HATE YOUR FACE" and "I'm BLS, Bitch" nature, but I tend to write those in my head as the situation progresses and then I forget them when I'm back by the computer. And my phone doesn't like the blogger. could probably find a better app but too lazy.
oh!

Whose genius idea was it to make a washing machine that takes 45 minutes to run and a dryer that takes 70? I know, I know, I could probably make the dryer time shorter but I kind of like my pants to stay pants, not capris. still. when I'm faced with The Nigh-Insurmountable Mound Of Clothy Death I want to shove it all back into the hamper and call it the 'clean clothes' hamper. then I'd have to put my dirty clothes into the dresser. ah, but then I could, once the hamper became empty, wash the clothes in the dresser and then the hamper would become the dirty clothes bin again! ...no?

The Boy and I are certifiably insane. (this you knew already, I know.) But further proof will be coming Labor Day weekend in the form of a ridiculously cute fluffball husky puppy.

yes. I know. insane.

but he's ridiculously cute. so cute, in fact, we forgot to take a photo when we put down our deposit. but he looks kind of like this:
The cuteness. it destroys your brain. Our cats will never forgive us.

Anyway. and now, for something...completely different. Well, not really. it's just time to go grocery shopping so I can go grill some fucking asian bbq steaks with brown rice and peppers.

(confused? click the linky from the beginning.)

we gave up stones and plundering but kept our fish and potatos.

2010-03-14T21:34:00.000-07:00

helt sant.

wait, what?

2010-03-12T12:05:00.000-08:00

sooooo our windows are definitely not insulated. how do I know this? IT'S FREAKING COLD. I could put on a sweater. or climb inside my tauntaun. or shut the blinds. but I'm lazy, and I like daylight, and I'm trying to finish a hat by...1400. keeeerap.

awaiting the ringidingy that tells me I get to go shell out a painful amount of cash and pick up my no-longer-broken car. What is it with Xterras recently? both Tweedle Dee and Tweedle Dum have been bashed upon. Poor Charlie and Mandy. But! birthday festivities this weekend, and dad's coming down for chair hunting and foods, so I'm going to go take off my crankypants, watch some craig ferguson (dvr's a biiit full) and crochet my fingers off.

yep.

oh yeah....

and...

ok, so maybe overdosing on finnish metal is what's really making the crankypants go away, and not any reall effort on my part. but, I mean...c'mon.

also...holy eyelashes, batman. I mean...damn. and I kinda feel like "I can play the keyboard while headbanging" should be a major marketable skill.

2010-02-21T19:23:00.000-08:00

made the mistake of listening to Who Puts His Trust today. after flipping through SEA pictures with Danber yesterday...bad idea.

really bad idea.

curse you muses!

2010-02-16T21:56:00.000-08:00

so just as I'm supposed to be knuckling down and getting that MOUND of fiber all spun up for my ravelympics project, I get mildly distracted by the thought of knitting a spectrum scarf.

and then, I'm (foolishly) bumming around Ravelry when someone links The Best Comic Ever in a thread talking about a genius who knit a different comic into a pillow, and its awesomeness, and it hits me: that comic isn't conducive to a pillow format, but...a scarf...

WANT.

of course, now I have to shut down The Brain before it gets sidetracked. spin, marit. Spin. spiiiiinnnnnn....

aMEN.

2010-02-10T19:20:00.000-08:00

http://jcs.biologists.org/cgi/content/full/121/11/1771

best. article. ever.

this post rated R by the MBB* for Language.

2010-01-18T09:14:00.001-08:00

woke up late.
stupid bike tire didn't want to go back on.
realized didn't have time to get lunch together.
tried (and mostly failed) not to be übergrump to The Boy. but he smelled good so hey, the morning's looking up.
stared at door, penguin sprinting, oh well, can't be that important. getting to work with enough time to shower and still be on time more important.
lock door, discover front wheel not turning. brake? no, brake fine. latching mechanism seems fine too. great. it's pissing rain, last chance for ride just left, not enough time to call my partner for ride, and now my fucking bike isn't working.
kick bike. ow fucking ow. (don't kick bikes.)
hey, bike rolls smoothly now. (I think my bike has been reading too much calvin and hobbes. it's after my blood and pain.)
bike to work. hey, asshole in the fucking prius, just because I'm already soaked does not mean I won't care if you puddle-drench me. jackass. when Claire rules the free world, you're going to the head of the
0753 clock in. god I hope no early calls because if mawit no shower, mawit kill. jump in shower.
was not hot. but wasn't cold, either, so...fine.
socks. fuck. that's what the penguin was trying to tell me. dry socks.

I want it all

2009-12-11T22:00:00.000-08:00

Some of the things I see on etsy make me go "ooooo...." and some of the things on etsy make my fingers itch and me go "whaaaaa? you're selling that for $30 bucks? have you SEEN that join? hello? THAT IS NOT FINISHED. go back and buff the shit out of that sucker, then we'll talk about selling that for $30 bucks."

I want my perfect world, where I get to spend my sommers at Skogfjorden, I get to teach college kids about science on a sailing research vessel every so often, I get to use my free time for knitting and designing knitting and I can set up a little loom and I can weave and I can coerce James into helping me build a little baby kiln and a little baby forgelet and I can set up my lovely cancer-causing mesothelioma-inducing studio and make jewellery and sculpt and make knives all day when I'm not working. And I want to have juuust enough money left over that every couple years or so I get to travel someplace awesome that I haven't been (Antarctica, Africa, ...must...beat (at the very least tie)...alex....), or someplace awesome that I have been to. (Alta, Santorini, and at this particular moment, Nuku Hiva), or maybe just a week of heli-skiing. and I want to go ski touring. I want to pack my bag and find a sledge or train up a pair of dogs and get my tent and some matpakker and my reinsdyrskinn and GTFO and not come back until håret e så fett det fryser!

I want it all.

I want it all.

And I want it now. *screeeeeeelm*

2009-12-08T19:30:00.000-08:00

Æ e FÆNMÆ ferdig.

My life according to Queen.

2009-12-04T23:16:00.000-08:00

Using only song names from ONE ARTIST, cleverly answer these questions. Pass it on to people you like and include me. You can't use the artist I used. (sure you can.) Try not to repeat a song title. It's a lot harder than you think! Repost as "My Life According to (ARTIST NAME)"

Pick Your Artist: Queen

Are you a male or female? Killer Queen

Describe yourself: I'm Going Slightly Mad

How do you feel: I Want It All

Describe where you currently live: Seven Seas of Rhye

If you could go anywhere, where would you go: Bohemian Rhapsody

Your best friend is: Good Old Fashioned Lover Boy

Your favorite color is: Flash

What's the weather like? Who Wants To Live Forever

Favorite time of day: Surf's Up...School's Out!

If your life were a TV show, what would it be called: Princes of the Universe

What is life to you: Bicycle Race

Your current relationship: Innuendo

Your fear: Death on Two Legs

What is the best advice you have to give: Somebody to Love

If you could change your name, you would change it to: Delilah

Thought for the Day: One Vision

How I would like to die: Fat Bottomed Girls

My soul's present condition: Radio Ga Ga

My motto: Let Me Live

today deserves...

2009-12-03T21:45:00.000-08:00

NO one's got enough blood!

...naked.

ok, now I feel better.

ohdeargod.

2009-11-22T22:05:00.000-08:00

it's November 22nd.

Ohgod.

T-minus 8 days and counting. EIGHT. ZOMG.

I can get by without sleep, right? all hail 1,3,7-trimethylxanthine! HAIL!

and laundry? what's that? The Boy can subsist on hotpockets and eggs, he's a big boy. Cat feeder and water are automatic. now all I need is TPN and a caffeine drip and we're good to go!

right?

guys?

cinematic nerdity

2009-11-15T23:22:00.001-08:00

I gotta say...Twister is a great movie. it's got action and comedy and great characters and pretty sweet special effects and best of all, it has people (acting) totally and completely passionate about their science. they geek out. I start watching and I get the goofy grin on my face. it's awesomely geektastic.

Oh XKCD. love.

2009-11-12T22:20:00.001-08:00

nanna-ream-o

2009-11-10T22:45:00.000-08:00

nano...sucking...brain..power...

also, why can't I write in my sleep?

and...one of the best episodes of the best shows ever.

although that clip does leave out one good bit, where daniel points out that they could be doing anything they wanted and they both freeze, then exit post haste.

teal'c with the thermometer in his mouth? never fails to make me crack my face in half with a grin.

ok. fold clothes. bed.

uh-huh.

2009-11-10T00:07:00.001-08:00

you know it's time for bed when this makes you burst out laughing.

thank you, and good night.

NaNoWriMo

2009-11-01T10:57:00.000-08:00

*cue pertinent Rimsky-Korsakov song*

too much crap to do today for serious writing BUT my reboot begins.

YES.

2009-10-27T21:09:00.000-07:00

Dammit, now I have to start watching Castle.

"didn't you wear that, like, five years ago?" SNORT.

yaarrrrrrn.

2009-10-27T19:00:00.000-07:00

so I'm trying to kick-start my yarn weight loss campaign again. not a diet per se...but if I want to start a new project, I have to finish something else. if I want to buy more yarn for a project, then a corresponding amount of yarn has to be either done or leave some other way. (the craft depot, gifted, osv.)

so far not much has happened. although that's mostly to blame the work schedule. but I need to finish:

northern lights scawl*, which at this stage is...yarn. and a pattern. sort of.
Giant Shawl Of Death, currently lurking reproachfully at me, since finishing it implies ripping out...pretty much the entire thing. yeah.
Mystery Afghan Thing, which right now is more like "mystery washcloth thing"
and others, but I'm all ufo-depressed now and anyway, it's time for NCIS.

*could be a scarf. could be a shawl. might end up being a cowl. who knows? also, sounds like 'scowl,' which is what I currently do when I think of it.

SUCH a good movie.

2009-10-15T21:59:00.000-07:00

Saving Grace. seeing that tv show (which is totally unrelated to the film) in the tv menu makes me go YA-oh. sad.

see?

one of the reasons I love this movie is that James is Grace. if James were a little welsh lady who started to grow pot to avoid bankruptcy. although when I watched it with him the scene where she cleans out her greenhouse gave him the twitchy fits. "but that's worth- that one's! but!"

"my name is tony, I am from scandinavia."
"...he doesn't talk much."
"mhm...does he have to?"

And the internet just ate the rest. bugger. oh well. here's one of the best bits:

I thought of this movie on the latest Crazy Day (which has been somewhat washed away from Drowning Marmot Day on tuesday, but involved an entire ER getting serious contact highs from a patient)

Penn & Teller.

2009-10-11T16:14:00.000-07:00

you just gotta love 'em.

theraflu-induced randomness.

2009-09-30T17:10:00.000-07:00

1) Mixed Berry with green tea and menthol Theraflu is more awful than normal Theraflu. I know, I know, I didn't think it was possible either. but trust me. Homeland Security, I got your new interrogation method right here.

2) I hate it when you're sick, so you take a sick day* at work, and then you wake up and you feel way better at noon-ish, so you think yeah, hey, awesome, I'll be back at work tomorrow, and then at 1500 suddenly you're back to sinus migrane of DEATH and taking the fucking recycling down and checking the mail makes you collapse back on the couch in exhaustion, and then you have to call in to work again for another sick day and you can feel the "...is it swine flu?" that's unasked and to make matters worse...

...it's time for more Mixed Berry Theraflu.

3) being mostly-catatonic has, though, given me a great gift: I finally got around to watching Glee.

seriously, the hours I spent going "meh, not so interested" are hours that I regret. deeply. I was never in a glee club (did Wayzata even have one?) but musical theatre is something I was raised on. you know in shows when people randomly break out in song? it took me an embarassingly long time to realize that normal people's parents don't sing phrases from musical of various obscurity in most situations. if no one else watches this show, my parents have to. the only downside to this is that I can't watch it with The Boy without sending him running for the hills.
(also, I've received the inability to type correctly. sheesh. dextromethorphan HBr and phenylephrine HCl and acetaminophen aren't altering drugs (besides, you know, sleepy-time), but you wouldn't know it by my typing skills)

4) New Dexter spot: artful cinematography paired with what song? Under Pressure.

this is why I love that show.

5)

6) Things Mawit Saw At Folsom:

Rainbow Brite (so not kidding.)
Guy Wearing a Snake (...only a snake.)
Guy Wearing a Hijab (...only a hijab.)
some really bad corsetry
some really good corsetry
lots of leather (well, duh.)
lots of nudity (also, duh.)
several small children (so not duh. really? yes, I understand, america is a little overly puritanical (ok, a lot) in some regards but...bob ditter says no!)
but the best thing was the XKCD tshirt on the guy wearing an interesting pair of pants.

7) the designers of the Breeze litterbox deserve sainthood. no kidding. by all rights should be stinkier than the lidded boxes we had been using (since they're open to the air) and granted, when Raz (who nearly got renamed Gollum/Smeagol) decides to leave us a present it's biohazard-worthy, but he actually usually succeeds in burying it and then we scoop it out (cause we don't have to fight with a lid and just scoop and dump) and then hey presto no stinky. and the pee goes down into a chuk and you don't change that for a week and it magically doesn't stink. Best. Litterbox. Ever.

8) I love Neil Patrick Harris.

9) Tsunami Watches are pretty boring, actually, which makes me sad that more people are talking about tsunami watch in the east bay than actual tsunami-earthquake-utter-destruction in Samoa.

10) Jayne is currently stalking an invisible critter that had damn well better not be a moth, because...well, it just better not be one.

11) every time I watch NCIS:LA I think of Katy because it's Chris O'Donnell. and good show, but...what's with the Incredibles lady?

12) Braid is an awesome game. if you've got an Xbox, you should buy Braid. so worth it. although if you play it for too long your brain goes splerkutyblip.

"when you're older, you'll find that will be a gift."

2009-09-30T15:31:00.000-07:00

SNORT.

Glee.

Watch it.

best fucking wednesday EVER.

2009-09-23T23:50:00.000-07:00

and it totally started out in The Pit...of Despaaaaaair, too, which makes it all the better.

the marmot gets essentially no sleep. Gets to work. boo, work. mawit tired. marit messed up proportions on coffee manufacturing in the morning. mawit sad. mawit gets coffee. things looking up. two calls down...then three...four...five. We're on our way to our sixth call and we drive past the Fox Theatre.

What's on the sign? Sep 23 Rodrigo y Gabriela.

what. WHAT. WHAAAT. mawit thinks "Dammit! I missed them AGAIN! WAIT! 23!!! 23 is TODAY!" grab phone. text mom to beg for info on concert start/price/etc.

starts at 8pm. tickets still available, 35 bucks. HELL. YES. text The Boy: hey remember rod y gab, want to go tonight?"

The Boy gets tickets with four minutes remaining. HELL. YES.

then, enter Murphy. we're delayed at our seventh call. dispatch has given us an eighth call, too, with a 5:30 pickup. PICKUP. mawit flips the fuck out. partner shakes head at mawit. of course we're gonna get a late call. we always get late calls. no, dispatch can't make it go away magically no matter how much you beg them.
mawit still flipping the fuck out because suddenly the great glimmer of hope that today wasn't going to totally suck is being eclipsed by yawning pit of despair.

on last leg of last call partner says something about bart and rides and mawit doesn't get it (because logic while flipping the fuck out? notsomuch.) the Boy calls. what's the deal? The Sainted Partner lays out the plan: The Boy meets mawit at work. The Boy and Mawit drive their car to BART. partner follows. we park our car at BART, hop in partner's car. partner drives us to theatre. (opposite direction of partner's home.)

cleared last call around 7:10. was at theatre by 7:45.

concert = win.

My pants....quacked.

2009-09-22T21:38:00.000-07:00

A Faerie Imp Trolly

2009-09-19T13:33:00.000-07:00

OH lord, I did NOT need to find this on a day when I'm trying to pretend I don't have to do anything but secretly (se..cret...ly) have waaaay too much stuff to do.

A Feral Item Pylori
Premarital Life Yo
Premarital Leif Yo
Paella Ire Mortify

I think this one's my Pirate Name of the day (it being Talk Like A Pirate Day):
Parlay Foe Limiter

you can apparently make lots of naughty anagrams with my full name.

and I want this shirt.

dresden FTW!

morngryn fortjener deng.

2009-09-10T07:28:00.000-07:00

or, crappy mornings deserve punishment. although combating crappy mornings with Queen is more like a reward...hm.

GOD I love that riff.

and you can't not love that song.

fried chicken!

and, because it's me, and we all know my neuroses (thanks MOM) (nah, just kidding, I like this particular neurosis.)

oh yeah. I think we should replace the statue of liberty with a giant statue of freddie mercury like the one that's in montreaux. colossus of rhodes style.

chick-en. good!

2009-09-06T15:31:00.000-07:00

otherwise known as...comic day!

Good, good book!

what's it about?

everything under the sun! did you know for example that alcohol is a waste product? all alcohol is made of small organisms that eat sugar and crap alcohol!
good, good book!

oh, xkcd. how is it that you almost perfectly understand my brain?

why does metal feel colder to the touch then wood when they're both outside?
they have different abilities to hold warmth. metal, being colder than your skin, transfers heat faster away from your hand and feels very cold to touch. wood is a bad heat transferer, and takes longer to steal your warmth. that's why it feels warmer to touch!
pff.
don't you believe me? she doesn't believe me! it's true!
wolf, wolf...
WHERE?!
Study again? Pff! If I could go to Hogwarts as Harry Potter and learned magic, I'd have applied there! I would have been able to learn to fly and such! -But to sit still and learn boring things and not be able to glue anyone to their chairs because you're over 20? No thanks! I can't imagine going back to school again. I am after all a grownup.
m-hm.

did you read...
sssh.
don't you think...
hush, you!
I...
seriously. shut up.
I just...
if you force me to discuss the news in these days, you have to pay for my therapy afterwards.

did you know that KISS have made KISS-coffins?
eeeew...Do you know what kind of coffin you want?
Cyan, now...
morbid subject, sorry.
it's not that. I just thought it was obvious. I want a treasure chest, of course.
of course.

(lik = corpse, kiste = chest, skatte = treasure, so coffin = corpse chest, see?)

you musn't say I'm sorry all the time.
I'm sorry.
I mean it! it takes a lot of courage to ask for forgiveness when you've done something wrong, but it's self-deprecating to say it too much!
I'm s- Shaddup.
wise girl.
With ninjalike invisiblity she sneaks herself gradually closer...her sleeping target notices nothing.
AAAARGH!
I HAVE NINJALIKE INVISIBILITY!
YOU HAVE ICE-COLD TOES!

Ow. What's this? today's newspaper? aha. I must have bought it on the way home. But what is this? Toast in the newspaper? aha. I must have made it. What's this now? there's been a robbery at a Burger King? ...aha...

ARGH!
What happened?
I heard sounds and my imagination ran away from me...it's easy to see things when you're in the woods. ...but it was only a guy who wanted to try to rob us. I kicked him in the balls and took his knife. he's not coming back.
...what were you afraid it would be?
the purple teletubby.

from blip. been there.

that's gonna be expensive.

and lastly, go HERE. now. but only if your sound is up and you're not at work. or in a meeting.

I'm ba-ack.

2009-08-15T23:20:00.000-07:00

Well, my stupid back is finally back to normal and The Incredibly Ridiculously Late Thing can come out of quarantine (I saw a moth. Teh Intarwebs suggests that it's not a clothes or fiber-loving moth, but rather a food-eating moth ((which I also doubt, because all my fuds are stored in containers purchased to repel The Ants Of Death, but whatever)) BUT I'm not taking chances. it's been wrapped up in the freezer for the past several weeks and gone over with a fine toothed comb ((can't wash, otherwise I would.)) and finally ready to be mailed. Ridiculously. Late.

Sometimes my job is a leeeetle inconvenient.
scary back-killing statistics aside. grumblegrumblefreakin'oldtowno-towngrumblegrr. I'd just like to be able to get to the post office....reliably. srsly.

Also, some part of my childhood just went either a) on a totally batshit crazy rampage or b) off to sob in the corner. Why? because there's a campaign to remove the Carl books from libraries.

THE CARL BOOKS. Good Dog Carl, you know? gorgeous illustrations of a wee little bebbie and her guardian rottweiler by Alexandra Day? largely responsible for my early programming towards big puppydogs? best kid's book ever?! (okay, maybe tied with the mouse books. and maurice sendak. and...ok, so there's a lot of 'best kid's book ever'-s. shush.)

because it encourages irresponsible parenting and encourages/indoctrinates young children with dangerous behavior.

What.

(This comic's first panel and this comic are once again pertinent, and as an aside, you should check out the first comic's author's new comic here.)

I shake my head in disbelief. Where are these people getting their drugs, and why aren't they sharing? although, if the drugs are making them go to crazytown I don't think I want them to share.

and finally...just because it never fails to make me smile...

dad! what? Dad! What?! DAD! WHAT?!?

2009-07-21T11:23:00.000-07:00

ah, Indiana Jones.

I made this one.

yesterday you may have heard a terrifying screech of agony around 8pm. that would have been me removing my eyes with a blunt spoon after the trailer for the new sherlock holmes movie came on the screen. *shudder.*

New Harry Potter was ...kinda boring. although in the theatre last night there were at least two other knitters other than me, because while everyone chuckled at one scene, a few of us laughed pretty loudly.

Matt and I want to see a Dresden movie. but I'd be a bit terrified of a Dresden movie. maybe directed by Tim Burton or Guillermo del Toro or someone who wouldn't kill it. and John Williams to do the scoring. yeah.

Oh so much win. SO. MUCH. WIN.

2009-07-17T22:23:00.000-07:00

seriously. Let's check that out again, for all y'all non-norsk-snakkende-folk.

also, I have known all of those people. Went to school with...eyep, all of them. caricatures, yes, but dead-on.

this merely reaffirms my desire- nay, need- to see Kill Buljo.

I HAS YARN!

2009-07-06T21:45:00.001-07:00

yarn that I made! see!

Here it is in progress...and here is my skein! whee!

not sure how many yards, and I still need to set the twist, but....YARN!

also, here's what's next:From my super awesome Gorey swap partner.

Also...Twister = best movie ever.

Science and pyrotechnics. nothing better.

WHEEEEEE!

2009-06-17T19:46:00.001-07:00

September the 7th is going to be a great day. An awesome day. A day during which Marit will not be allowed to drive a motorized vehicle. Why?

Because we've already learned that Marit + Rodrigo y Gabriela = full-on PD attack. can't drive and drum at the same time.

And because the new Rodrigo y Gabriela album 11:11 is coming out that day.

So. Much. Awesome.

he's like a mr wizard for food, but extra cheesy.

2009-06-13T19:35:00.000-07:00

A curious thing happens when you watch too many episodes of Good Eats. You start to crave everything you see, even things that don't really seem all that appetizing. (like homemade chicken fried steak...three different ways.) And you start to lust after every single gadget. (like cast iron broilers. and mini spatulae. and squeezy plunger beaker meauring cups. and beakers. and....um...small apartment, marit. small. apart. ment.) And then, you decide that the perfect food to make for dinner tonight is an english rib hungarian goulash...that takes at the minimum something like 10 hours to make...and it's already six o'clock. you briefly consider it anyway.

I call it Food Schizophrenia. I got it bad.

on the plus side, it's keeping me from marching down to my renter's office and demanding money for reparations for all the anguish I've endured dealing with ridiculously fucking shoddy 'renovations' done in my apartment. The painters were clearly trained apes (without the training): my closet doors weren't stripped before they repainted them white, and they didn't take them down when they repainted because there is a strip of old dingy cream hidden above the track, which is also covered in blobs of paint, and the hardware hanging the doors is completely covered with paint so a 2 minute rehanging job turned into 40 solid minutes of angry pounding and drilling...nor were the chipped edges of walls treated before they were repainted, so in places the metal framing edges are covered only by a coat of paint, they painted completely over the fuse box...and I'm pretty sure the walls are painted in primer.

dammit. now I need to go watch more Good Eats.

might?

2009-06-09T13:18:00.000-07:00

marit freya's Dewey Decimal Section:

512 Algebra

marit freya's birthday: 5/29/1983 = 529+1983 = 2512

Class:
500 Science

Contains:
Math, astronomy, prehistoric life, plants and animals.

What it says about you:
You are fascinated by the world around you, and see it as a puzzle worth exploring. You try to understand how things work and how you can make them better. You might be a nerd.

Find your Dewey Decimal Section at Spacefem.com

...I just used a meme that told me what my dewey decimal would be. I think any question about my being a nerd is moot.

laughing so hard I'm crying.

2009-06-07T21:23:00.000-07:00

seriously.

I love XKCD. LOVE. oh, Mr Munroe, you are a genius. Friday's was awesome:

but this one...might be the turning point behind me getting that Height poster I keep eyeing, or the Stand Back: I'm Going to Try Science! shirt, or the SCIENCE It works, bitches. shirt.

and there is a killer pillow on ravelry that I want, although I want it to be this panel instead, which is somewhat more complistercated.

Movies Part Deux.

2009-06-01T22:44:00.001-07:00

Night at the Museum 2 is not nearly as entertaining as Night at the Museum. (Also, Amy Adams as Amelia Erhart is kinda creepy.) But sufficently entertaining enough that I didn't fall back on my usual reaction to Ben Stiller. (clawing off my face screaming incoherently Oh God The Pain...although if I'm screaming oh god the pain is it really incoherent? maybe for you. I know I'm showing my alien heritage in expressing that sentiment...but...really...Zoolander. need I say more?)

Star Trek is still pretty freakin' cool. Not as cool on non-Imax (even halfassed Imax), however, so if you can hit up the Imax, do so. you may be able to discern individual nosehairs, but the forebrain will be going "oo....shiny....." enough to make up for it.

Did I see any new previews? um...oh. yeeeees. Hollywood is so starved for ...I don't know what... that they're actually making another alvin and the chimpunks movie. I don't remember anything else, the alvin scared it away.

Movies...

2009-05-26T20:43:00.001-07:00

Star Trek:
Awesome. Went to a matinee, but would have willingly paid a) actual movie prices b) actual imax prices and even c) actual imax prices at a real imax (not AMC's stupid I'm-an-imax-but-actually-not-really-teehee-suckers) in California. It reminded me of when I was younger and running around with Dithy and Teri debating whether Riker or Picard was better (as I recall Teri voted Riker and Dithy voted Picard) and adding to the Weirdo Chant and all manner of ridiculously awesome things. Am quite willing to see it again.

Terminator Salvation:
Terminatedest? oh wait, that's Die Hardester. Wrong franchise. Pretty good. Although at times I think Christian Bale forgot he wasn't being Batman and started to talk in the Batman voice. I can well understand why he could go into crazy flipout mode, especially during certain scenes. Watching the credits roll in the beginning was sort of entertaining, kind of like when the credits rolled at the end of Star Trek and everyone in the theatre said Winona Ryder?! WTF!? Also: I never ever ever ever want to see the governor of my state bare-ass naked on a giant fucking screen ever again. I don't care if he's digital. EW.

Angels and Demons:
Pretty good. I was very very disappointed when the credits in the beginning were rolling and then the title splash screen came on...and it wasn't the Angels and Demons ambigram. hello? whole damn book is based around ambigrams, and you give me a stupid boring text title? Also, totally gratuitous extended Tom Hanks-in-a-Speedo scene. Dudes. Ew.

In terms of previews:
Public Enemies looks good. (is Christian Bale in every movie?)
O You who are responsible for that heresy that is Sherlock Holmes? you're headed straight to the 9th circle of hell. seriously. Someone find a way to harness the energy caused by Sir Arthur Conan Doyle turning in his grave. Mr Downey Jr? Jeremy Brett is coming for you. he's coming back from the dead for you, and he's going to kick. your. ass. and I'm going to cheer him on. omgwtfbbq. There's not enough -OH groups in the world to make me go see that movie.
Julie and Julia could be entertaining.
The Sandra Bullock movie could also be entertaining. it's quite likely that all the funny bits are in the preview, but they're pretty funny bits.
Night at the Museum could be funny. The first one was surprisingly good, and I am usually heavily allergic to Ben Stiller.
Don't know about Up.
Land Of The Lost: ....Will Farrell...please...go...away...please...
Taking of Pelham 123: ...John Travolta is creeeeeepy.
Year One is another one of those weeeeelll...maybe....could be good, could be Zoolander.

I can't remember any others.

Oh but the nurse on the new showtime tv series? her twin works at one of my hospitals. (yes, *my* hospitals.)

Spiders.

2009-05-21T19:36:00.001-07:00

There are no brown recluses in California. I've lived in the heart of recluse-dom and never encountered one. Black widows we got, though, in spades, though I haven't seen one here yet.

There are, however, GIANT FREAKING SPIDERS IN MY HOUSE.

So I'm checking my email and the cat bowl starts whining that it's out of water and the pump's running dry. I unplug the fountain-the italics will make sense here in a second-and go fill it. I return, fiddle with the dome until it sits right, then go to plug in the fountain. Huh, there's a dark blob on the bottom edge of the outlet plate. cat poo? no. dust bunny? no. what is- HOLY SHIT HUGE SPIDER. I call The Boy, who comes grudgingly* in.
The Boy: WHAT THE HELL IS THAT?! is that a black widow?
Me: uh...no.
The Boy: are you sure?
Me: uh...yeah. pretty damn hard to confuse a spindly shiny black little-head-giant-teardrop-abdomen with THE SPIDER OF FUCKING DEATH. (I am dramatically re-enacting this part. I just said yes.)
The Boy: holy shit that's big.
Me: Yeah. don't kill it yet I want to get a picture.

...so the cats seem to have kidnapped my little card reader thing (it is moments like this when I wish The Beast were still alive.) so I can't post the picture I took, which is probably OK because it wasn't the greatest of photos. Anyway. IT. WAS. BIG.

and now, I have to try to sleep...with two thoughts in my head.
1) how the hell did Monster Spider get in my house?
2) where the hell are his buddies?

*I am a cool cucumber when it comes to spiders outside my house. in the great outdoors, I am even fine as long as said spider stays off my person. (....and as long as I don't walk face first into a freakin' three-foot-wide garden spider web.) In my house, however, I am your stereotypical squeaky shivery omggetitoffgetitoffkillitkillitkillitkillitkillit girl climbing on chairs. Thus it is usual for The Boy to just say "so kill it," before eventually relenting and saving me from the horrible beast. I'm sure he's confused as to how exactly I made it through Entomology. (simple. Entomology =/= Arachnology.)

I have abby-someone cats.

2009-05-17T22:40:00.001-07:00

Raz: why is box making funny noises?
Jayne: I can't get out of the box!!1! I CAN'T GET...oh wait. I claim this as my box.
Raz: ZOMG strange cat kill-oh, it's you.
Jayne: *bap*
Raz: what's this? I'll bite it. mmm, cardboard. ZOMG STRANGE CAT-oh, it's you.
Jayne: what's that? umf, my box is little. oo, shiny...slobber HEY you bit me.
Raz: now it's my box. can I fit in my box?
Jayne: no, mine.
Raz: MINE.
Jayne: fine, I don't want it anyway.
Raz: well I don't want it more. *huff*

happy 17. mai!

2009-05-17T13:47:00.000-07:00

...you know, if I were here right now? it would be a lot cooler. it's about 12 degrees C. (54 ish F.) but probably just as light. even though it's almost 2300.

yay, midnattsolen. also, guess what I love about this weather map-
did you get it? the little partly cloudy symbols change from a sun to a moon as you go further south. ehehehe. also, poor Christian's getting rained on. looks like Kjersti's got sun though.

but yes! happy 17. mai and happy birthday craig ferguson. happy bay to breakers, which apparently this year will not have any nudity or keggers. riiight. I was going to go watch but dude...it's hot. way too hot to do anything of substance.

must...gain...energy...to...clean...fridge...wait, the fridge is cold. ok, I can handle that.

brain filtered for your safety.

2009-05-16T09:44:00.000-07:00

from Mythtickle:

DADA!!!!! ehehehehehehe.

From the awesome Girl Genius:

eeeeebil social scientists. are there really any other kind?

more nemi! (that's a link to a newspaper, I can't seem to find a home site for Lise Myhre.)
That is the worst thing I have read....but now at least there aren't any more dustmites here!

I am very good.

why's that?

I'm not telling you how many bacteria you have in your body.

and from Brat-halla:

:) oh, Hod.

Man....

2009-05-09T17:31:00.000-07:00

...I really want another tattoo. *sigh* Or maybe I just need to stop looking at ones like these: I mean...heckel? awesome? although I'd prefer some of Leuckart's stuff. and...oh, paleontology, one of my first loves...

but first....need money. money not earmarked for more important things. and need some printable temp tattoo paper.

hell yes.

2009-05-07T22:21:00.001-07:00

Thanks for signing my petition for the environment! We need as many people as possible to take a stand for our world.

We've got to- it's the only planet I know of with longhaired men and chocolate.

happy belated may day.

2009-05-02T14:38:00.000-07:00

Just got home from X-Men Origins: Wolverine. The Boy said that it was 'okay.' I thought it was pretty good, but then Hugh Jackman spent pretty much the entire movie shirtless. I can forgive a lot of plot mistakes/special effect mistakes for certain concessions. Usually. Troy's at the limit.
I was going to post this on the appropriate day but I forgot. so...belated April Fool's Day, too.

Luther professor wins role as Dumbledore

Date 4/1/2003 12:00 AM | Topic: News

Warner Brothers Pictures announced this week that Fred Nyline, Luther College Professor of Music and director of Luther's bands, is to replace the late Irish actor Richard Harris in the role of Albus Dumbledore in the Harry Potter franchise.

"The death of Richard Harris left pretty big magical shoes to fill," said Chris Columbus, director of the first two Potter films. "He became an icon for children around the world. At first we thought that replacing Harris would be a problem, as children would be comparing the new Dumbledore to the old one," Columbus added. "The executives at Warner knew that the actor we chose had to be perfect; we could not afford to fail."

"I really didn't expect to get it," said Nyline, "my grandchildren made me do the audition. I'd do anything for those kids."

Nyline is no stranger to the screen. He starred in the original 1947 production of "Miracle on 34th Street" as Santa Clause. He is also a veteran of major movie franchises, having played the British super-spy James Bond three times in the late 1960s.

As part of the audition process, Nyline had to meet with Harry Potter author J.K. Rowling. Rowling had dismissed other popular choices for Dumbledore such as Sir Ian Mckellan, who played the mighty Gandalf in the "Lord of the Rings" franchise. "Ian just didn't do it for me," Rowling said. "Don't get me wrong, he's great, but I really didn't think he captured the true spirit of Dumbledore. When Fred walked into my office, I knew immediately that he was the one. He is everything Dumbledore is. He's just so darned adorable! Kids will love him."

Children everywhere are responding very positively to Nyline. British children are already discarding their Richard Harris inspired Dumbledore dolls for the new line modeled after Nyline.

"Being an action figure is strange," Nyline told David Letterman during a Late Show appearance. "The kids back at Luther love it though. For my students, it's not much of a stretch to see me hold a magic wand. I conduct the band with a wand-like baton everyday."

Being a movie star has changed very little for Nyline. "He's like Superman!" exclaimed tuba player Tim Arnold ('04). "Even though he's Dumbledore now, he's still directing the band, and still dolling out the same wisdom he always has. Just the other day, before he flew off for another day of Potter filming he reminded us, 'Stay out of work, stay out of trouble, stay out of jail.' What a guy!"

Nyline is slated to portray the great wizard for the next five films, and regardless of the grueling filming schedule, he intends to keep on directing the bands at Luther. "Everything I do, I do for the kids. Being Dumbledore is just one more wonderful thing I can do for children everywhere."

Luther College is very excited for its distinguished faculty member. "This will attract a lot of students to Luther," says President Richard Torgerson. "Everyone will want to be in Dumbledore's band."

Frank Vomis
Chips Freek Editor

oooowwwwwwwwwie.

2009-04-30T19:44:00.001-07:00

ow. I has hurt. (like ich habe hunger-unger-unger-unger, only more painful and less melodic.)

why has I hurt? Well, Le Marmot went for a run yesterday. (a jog. Le Marmot does not likey the runny. Why does Le Marmot not likey the runny? take the contents of a 16 or so ounce can and put them in a plastic baggie. repeat with another can's contents. now put on a bra and insert baggies. now go run.) Le Marmot also doesn't likey the runny because she's not in the best of shape, if we're being honest. but mostly: boobs. ow. if someone has Teh Miracle Bra please tell me because my sports bra just gives me one floppy uniboob.

Then, Le Marmot did some yoga/strength training on the Wiifit.

that was yesterday.

Today, I got to spend an entire call holding an IV bag over my head, because our gurneys don't have IV poles (because they all got stolen from our station and sent into the city) and because for some reason they didn't mount a hook on our rig. (Like they didn't mount an EMT-catcher, which is my favorite thing evar. not. especially when we're on the freeway. hit the brakes too fast or swerve and I'm eating cabinets. with my face. woo. hoo.)

and then we had a stair chair call. (hey, you guys wanna run one more call? pretty please? it's a discharge and it's only 3 miles away? sure, we'll run it. ok great! um...there's stairs, do you have a stair chair? ....grmblersgrnfrazzer yes.)

now I feel like Kronk in Emperor's New Groove: "back elbows shoulders *thud*"

Also, question: how in the hell do you interpret this:

For the holy spirit and we ourselves have favored adding no further burden to YOU, except these necessary things, to keep abstaining from things sacrificed to idols and from blood and from things strangled and from fornication. If YOU carefully keep yourselves from these things, YOU will prosper. Good health to YOU!” (acts 15:28-29)

which is the same as this:
For it seemed good to the Holy Ghost, and to us, to lay upon you no greater burden than these necessary things; That ye abstain from meats offered to idols, and from blood, and from things strangled, and from fornication: from which if ye keep yourselves, ye shall do well. Fare ye well.

to mean blood transfusions = evil?

and also...why is YOU capitalized everywhere, but yourselves isn't? shouldn't it be if YOU carefully keep YOURSELVES? ...skippy. box. now.

Haven't done this in awhile.

2009-04-26T00:14:00.000-07:00

Your Life: The Soundtrack Created by aiko and taken 167054 times on Bzoink
Opening credits:	Star Wars Theme (techno remix)
Waking up:	She Blinded Me With Science! (Thomas Dolby)
Average day:	Vi Krangler (De Lillos)
First date:	Sigur Ros (Sigur Ros)
Falling in love:	Prime Audio Soup (Meat Beat Manifesto)
Love scene:	Contact (Rent Original Broadway Cast)
Fight scene:	Bach's Fantasie in C Maj BWV 570 (Empire Brass and Bill Kuhlman Baroque Music for Brass and Organ)
Breaking up:	One Headlight (The Wallflowers)
Getting back together:	Hår Som Spunnid Gull (Lumsk)
Secret love:	Hver Gang Jeg Går Rund Her (Postgirobygget)
Life's okay:	Dirty Dancing (Black Eyed Peas)
Mental breakdown:	Bak Et Halleluja (Kaizers Orchestra)
Driving:	Tamacun (Rodrigo y Gabriela)
Learning a lesson:	The Happiest Days of Our Lives (Pink Floyd)
Deep thought:	Gia Sena (Elli Kokkinou)
Flashback:	The Climb (No Doubt)
Partying:	Juta (Georgia State Dance Company Orchestra)
Happy dance:	Eye Patch (Robert Rodriguez/Once Upon A Time In Mexico)
Regreting:	Marillion (Paul Oakenfold)
Long night alone:	Don't Speak (No Doubt)
Death scene:	Gjendines Bånsull
Closing credits:	Cambodia -Fragma Remix (Pulsedriver)
You've been totally Bzoink*d! Take This Survey \| Search Surveys \| Create a Survey

Waking up is quite likely. My fight scene...seems a little strange. I think Breaking Up and Getting Back Together are backwards.

Got out of town on a boat for the southern islands...

2009-04-24T23:41:00.000-07:00

I stole this from Pixiethief, who stole it from someone else in turn.

01. Make a list of 5 things you can see:
1.) Kittens attempting to kill each other
2.) the project bin that's achieved sentience (or at least sexual maturation. it's breeding. trust me. that half-spun green fleece was not there yesterday.)
3.) My poor lily-of-the-valley plant that needs water.
4.) the nerdiest guitar hero guitar ever.
5.) The wiifit, which is frowning in disapproval at me.

02. WHAT'S THE FIRST SCAR YOU EVER GOT?
The bump on my lip and eyebrow slice from faceplanting onto an ice slide in 4th grade is the earliest thing I remember. (They match nicely with the scar from sticking a braces bracket through my lip faceplanting off a 60-in play ball, which lines up perfectly with the scar from faceplanting into a slate-bottomed stream (sensing a theme? hey, at least I saved the camera!*) and makes it sort of look like I was in a knife fight.) I'm sure I have something from earlier. Mom?

03. Is there anything in your fridge right now that you would never eat/drink?
Matt's French's mustard. *shudder*

04. What's your occupation?
Sir/Ma'am-I'm-an-EMT-can-I-help-you?

05. Do you nap a lot?
Not really. I tend to need more than 3 hours or less than 10 minutes. I do a lot of middle-distance staring, though, which might count.

06. What was your first celebrity crush?
Adrian Paul. or Johnny Depp. But most likely Adrian Paul.

07. What's your current fandom/obsession/addiction?
Firefly, making sure the eel is still alive, iced espresso con panna from the little italian cafe, the next Dresden book.

08. What are you listening to right now?
Bill Maher.

09. What was the last text message you received?
Something from Mom, I think.

10. What websites do you always visit when you go online?
Gmail, Ravelry, several webcomics.

11. What was the last thing you bought?
Saline.

12. Cutest thing you have seen today?
Raz pleading for my ice cream.

13. Does the weather affect your mood?
not usually. unless it's snowing. then I get ridiculously happy. Snow!

14. What is your zodiac sign?
Gemini

15. Pets?
Jayne, the box dropping man ape gone wrong kitty, and Raziel, the crazy psycho jungle kitty that I wanted to name Mister since he's huge and grey, but The Boy wasn't interested. two bettas, a goldfish named Aurelius, an african dwarf frog named La Grenouille, an eel named Amore, and a smattering of white cloud minnows, blue danios, and longfin cherry barbs.

16. A saying you live by/that you have remembered and has inspired you?
From Mr Nyline (my band director at Luther, said after every band rehearsal.):
Stay out of work, stay out of trouble, stay out of jail. (sometimes he ended with "Stay hungry.")

17. What is the story behind your username?
I think it was james or xander who first started calling me marmot, which is one of the few nicknames that stuck, and I knit, so...marmotknit. (my old lj was picklechild, which has a long and mostly-inappropriate backstory involving the renaissance festival and the pickle sellers.)

18. What's something you'd like to say to someone right now?
I caaaaan't take any more songs with the word 'shawtie' in it. OMGMAKEITSTOP.

19. What are your plans for next weekend?
not sure yet. The Boy has to work, so probably nothing exciting.

20. Say something to the person who tagged you:
rather existential since no one tagged me.

*so I'm towards the rear of my classmates, and we're sprawled over a wide swath of vidda hiking back to civilization, and I'm fording a stream. For the record, slate + a few inches of really cold water = slippery rocks that slide around amongst themselves. I slip. My camera is around my neck and one shoulder, standard carry position, and as I'm falling I take it in one hand to keep it out of the water or from being smashed between me and the rocks. This leaves me with one hand to stop me and my giant-ass purple pack from going splat. I retain the presence of mind to not stop myself with an outstretched hand, and smack the ground. Ow. Get up, inspect camera- a little bend on the filter edge, but that's ok. why does my lip hurt? *prod* oh, look, lots of blood. I look up and Levi is standing next to me, observing the events of the past few seconds. he hands me a cloth of some ilk, then steps back and shakes his head slightly, saying only "...Foto." (the shorthand for our photography class.) Four stitches (sans novocaine! OW bloody OW!) and I'm impersonating angelina jolie for a week.

because every so often...

2009-04-24T22:05:00.000-07:00

...you just need some firefly.

I have a ranty but I'm too tired to be coherent or fair. so maybe tomorrow. For now, Firefly.

Mal: If anyone gets nosy, just, you know, shoot 'em.
Zoe: Shoot 'em?
Mal: Politely.

Mal: See, this is a sign of your tragic space dementia. All paranoid and crotchety, it breaks the heart.

Mal: "This isn't happening." (to Saffron) "Will you stop crying?"
Inara: "Oh, for God's sake, Mal, can you be a human being for thirty seconds?"
Wash: "Speaking as one married man to another..."
Mal: "I am not married!" (to Saffron) "I'm sorry. You don't shame me, you have very nice qualities but I didn't ever marry you."
Book: (holding encyclopedia) "I believe you did. Last night." (Mal hesitates, steps toward Jayne
Mal: (to Jayne, quiet) "How drunk was I last night?"
Jayne: "I dunno, I passed out."

Zoe: Sir, I think you have a problem with your brain being missing.

Wash: "Don't fall asleep now. Sleepiness is weakness of character. Ask anyone! You're acting captain. Know what happens you fall asleep now?"
Zoe: "Jayne slits my throat and takes over."
Wash: "That's right."
Zoe: "And we can't stop it."
Wash: "Well, I wash my hands of it. It's a hopeless case. I'll read a nice poem at the funeral. Something with imagery."
Zoe: "You could lock the door and keep the power-hungry maniac at bay."
Wash: "Oh, no, I'm starting to like this poetry idea now. 'Here lies my beloved Zoe, my autumn flower, somewhat less attractive now she's all corpsified and gross'..."

Zoe: Planet's coming up a might fast.
Wash: Just means I'm going down too quick. Likely crash and kill us all.
Mal: That happens, let me know.

Mal: Define 'interesting.'
Wash: "Oh God, Oh God, we're all gonna die?"

Wash: You want a slinky dress? I can buy you a slinky dress. Captain, can I have money for a slinky dress?
Jayne: I'll chip in.
Zoe: I can hurt you.

Kaylee: These girls have the most beautiful dresses. And so do I, how 'bout that!
Mal: Well, careful with it. We cheated Badger outta good money to buy that frippery. You're supposed to make me look respectable.
Kaylee: Yes sir, Captain Tightpants.

Jayne: We need a di-version. I say Zoe gets nekkid.
Wash: Nope.
Jayne: I could get nekkid.
Simon/Zoe/Wash: No!

Badger: "Why ain't she talking? She's got a secret."
River: "Sure, I got a secret. More'n one. Don't seem likely I'd tell them t'you, now, do it? Anyone off Dyton Colony knows better'n t'talk t'strangers. You're talkin' loud enough for the both of us, though, en't'ya? I've known a dozen like you. Skipped off home early. Run graft jobs 'ere and there. Spent some time in the lockdown, but less'n you claim. Now you're what? Petty thief with illusions of standing? Sad little king of a sad little hill."
Badger: "...Nice to see someone from the old homestead."
River: "Not really." (to Simon) "Call me if anyone interesting shows up."
Badger: "I like her."
Jayne: "That right there? Exactly the kind of di-version we coulda used."

Mal: How can you say that? How can you shame me in front of new people?
Jayne: If I could make you prettier, I would.
Mal: You are not the man I met a year ago.

River: Noah's Ark is a problem.
Book: Really.
River: We'll have to call it early quantum state phenomenon. Only way to fit five thousand species of mammal on the same boat.

River: Also, I can kill you with my brain.

Mal: "And Kaylee, what the hell's goin' on in the engine room? Were there monkeys? Some terrifying space monkeys maybe got loose?"

Simon: My sister's a ship. We had a fairly complicated childhood.

Jayne: "Well, I say as a rule that girlfolk ain't to be trusted." River: "Jayne is a girl's name."

Mal: "I hate to bring up our imminent arrest during your crazy time, but we gotta move."

Zoe: "River, honey? He's putting the hair away now." River: "It'll still be there... waiting...."

Jayne Cobb: I once hit a guy in the neck from 500 yards with a bent scope. Don't that count upstairs?
Book: Oh, it'll be taken into consideration.
Jayne Cobb: You made that sound kinda ominous.

Jayne: "Anyone remember her coming at me with a butcher knife?"
Wash: "Wacky fun..."
Jayne: "You want to go, little man?"
Wash: "Only if it's someplace with candlelight."
Zoe: "Sir, I know she's unpredictable, but I don't think she'd harm anyone.
Jayne: "Butcher's knife?!"
Zoe: "Anyone we can't spare."

Inara: "Every well-bred petty crook knows -- the small concealable weapons always go to the far left of the place setting."

Mal: Try to see past what she is, on to what she can be.
Zoë: What's that, sir?
Mal: Freedom, is what.
Zoë: [pointing] No, I meant — what's that?
Mal: Oh. Just step around it. I think something must've been living in here.

Zoë: Get her running again?
Mal: Yeah.
Zoë: So...not running now?
Mal: Not so much.

Jayne: "You know what the chain of command is? It's the chain I go get and beat you with until you understand who's in ruttin' command here. (beat) You can't change that... by gettin' all... bendy."
Wash: "All what?"
Jayne: "You got the... the light... from the console... keep you... lift you up. They shine like... (snatching at the air)... little... angels..." (falls over, unconscious) Wash: "Did he just go crazy and fall asleep?

Mal: "But she was naked! And... ...articulate!"

Sigh. Best. Show. Ever.

With Apologies to Pliny the Elder.

2009-04-14T21:06:00.000-07:00

Just shy of 50,000 dollars for a year at the Monterey Institute. I'd need 2.

well, fuck.

on the up side, even though Teh Intarwebs says you could have all manner of nasty, permanent, possibly-fatal diseases, it's vanishingly unlikely that you actually do, and the doctor will tell you that. Which is what I was expecting. Still. do I get points for creeping out the doctor? ("If that's what you expected...why did you come in?" "because murphy moves in mysterious ways." "...I'm sorry?" "murphy. Murphy's Law. Anything that can go wrong, will? or O'Toole's commentary on Murphy's Law? Murphy was an optimist?" "oh..kay?" "nevermind.") (she really should have been suspicious when I wrote on my drug history "ibuprofen/acetaminophen prn cramps/headache." the nursing assistant pointed to prn and asked me what that word was (yes I have scribbly writing SHUTUPdie). I said "prn. pro re nata. for the thing (which has been) born, or appeared...or less literally for the reason that appeared, or....(as I take in look of 'ohdeargod she's crazy')...um...per patient request." Yes, I said pretty much all that. it is NOT my fault, it was 0725 and I had NOT been allowed coffee AND I'd been awake since 0545.

I blame genetics. I'm betting bits of my DNA don't actually say GACTGACTATGCGCTATAATGC but ΓΑΧΤΓΑΧΤΑΤΓΧΓΧΤΑΤΑΑΤΓΧ.

So Depressing.

2009-04-09T22:20:00.000-07:00

These requirements are for a job that pays 3 to 6 dollars more than my current job.

Requirements: H.S. diploma. Familiarity with data entry, high attention to detail and accuracy, flexibility, and good communication skills are needed. Ability to follow laboratory protocols and access to a car are required. Previous experience in specimen handling is desirable.

whatdefmrgl. seriously.

three....darts....is....too...many....

2009-04-03T23:07:00.000-07:00

caffeine, don't fail me now, baby.

Pumpkin Pie the First: done.
Pumpkin Pielet the Second: done. a bit too done. oh well. it's not really a pielet. it's just a little less...dense. yeah. that's it.
Margarita Pie the First: ...shush.
Margarita Pie the Second: ...uh...dependent on marit finding another can of sweetened condensed milk somewhere. this is not as big of a stretch as you might think.

what time is it? oh yeah....crap.

Am also supposed to finish up my last moleskine and go, but I need to sit down, stare at it, and repeat to myself "Marit. Perfectionism is BAD. It's fine. It's done. Remember Mrs Hess? Forcibly taking away your self portrait? Mrs Hess is, right now, at this very moment, twitching, and she doesn't know why. Put. The Sketchbook. Down." until I can shove it in an envelope.

what did we learn today, kids? Don't mention Iowa being more awesome than California to a Witness. (I mean...it's Iowa. ...not Luther, but Iowa. I-ow-a.)

Also, How To Make Someone's Eyes Go Boogley and Score One For Classical Dance: find a video on youtube of a professional male ballet dancer warming up with a rig on that shows muscle strain and forces. watch fellow EMT eyes go boogley and hear lots of "WTF is that?" "that's a quad." "that can't be a quad muscle. that's fucking huge." Yes, boys, tiny sissy little dancer-man can break you. in half. without breaking a sweat.

funfact? Adrian Paul is exactly 24 years older than I am. Yes, you're going to have to put up with more geekiness. this is what comes of being all post-migrane-fucked-up and watching a whole day of Highlander. I'm singing Queen to myself and making my partner look at me funny as I do parry drills waiting in hallways.

there is a plus side to recovering from Migrane Madness.

2009-04-02T20:08:00.001-07:00

Scifi has been running a marathon of Marmot's favorite guilty pleasure.

what? if I'm going to be scrubbing bloodstains out, it might as well be to the tune of the sexiest theme song by the most awesome band ever with the so-jumpworthy* Adrian Paul.

yes I realize that that sends my geekness quotient into the stratosphere, and I don't care. one of my partners was playing with my phone, and one of the random songs I managed to get loaded is that theme song, and it played. He looked at me and said "HAH you totally just had a guilty little look on your face!" and I went "well...it's....Queen." and there was a long pause. "And I am somewhat of a sucker for guys with long hair and swords, so sue me." and he said "yeah, I saw that coming." I don't know why.

*total high school flashback. whoa. Hi Kirsten! oh man. his bassness. such young foolishness.

depressing drooling.

2009-03-22T22:45:00.000-07:00

Watching Planet Earth: The Future is an interesting dichotomy; part of my brain is going "oooo...sooo..preeeeetttyyyy......" and is good for nothing but drooling, and another part of my brain is listening to what they're saying and is getting ridiculously depressed, and wants to quit watching. but that impulse gets smashed by the other part of the brain that says "SHUTUP PRETTY LOOKIT BIKKIT*". I suppose I could watch it on mute, but then I'd get confused by all the faces.

*wanna wanna 'lefant lookit 'lefant!**

**Thief of Time.

O.o

2009-03-19T22:32:00.000-07:00

....O.o

Gratuitous Kitteh.

2009-03-18T17:14:00.000-07:00

I think my email may have eaten my proposal, which makes marit sad. so does having helicopters run laps seemingly a foot above my roof at 2200 when I'm trying to sleep. They didn't stop until 2300ish. I don't care if they were zombies or a breakout from the police station...don't you people know I had to be up by 0300? siiigh. Biking this morning went fine until partway through my ride when the Light Of Elune became the Light Of Doom and began fading (and like most high-candlepower lamps, when they fade, they fade faaast.) just as I hit the darkest point of the ride. Now, of course, every zombie movie I've ever seen begins to play in my mind, AND the random function on my mp3 player flipped over to ambient trancey-creepyness* (I'm looking at you, phillip glass.). It's dark, it's cold, it's quiet, and the moon is a huge orange slice hanging low in the sky, and did I mention the fog? this fog didn't come on little cat feet. little godzilla feet maybe.

On the upside, I made my usual 10-12 minute ride in 7 minutes. Anyway, to make up for the whining, here's kitteh pictures. (I just cleaned out my memory cards, can you tell?)

*not usually creepy. usually quite nice. not at 0320 am after zombies have been mentioned. also, apparently I have the Coast Guard to blame. hope they found him.

NeeeeEEEEeeeerrrrrrryyyyyyyoooooooommmm.

Look, ma, I'm serious-cat! I swear! ...zzzzzzzzz

Raisins, guys. I know it's a crinkly red bag, but we've already established raisins =/= food. leave me alone. Also; Raz = longcat. he can get the first knuckles of his paws over the edge of the counter.

I come home one day and Raz is staring at the corner of the door. for hours. um...raz?

Just say no to catnip, Jayne! Jayne...that's the heater. stop rubbing it.

Why do you tempt fate, o hooman? you know I'm going to destroy that handspun the second you leave it unattended...oh, you want to sit? no. my chair. go'way.

Chef!

2009-03-15T22:01:00.000-07:00

mine is an evil laugh!

2009-03-14T22:18:00.001-07:00

so....why did the new dexter book come out in mid-february in the UK, but isn't coming out until september over here?

that's crap. ((Also crap; I can play itunes music on my shiny new zen (whee refurbished $40 2gb-that-accepts-SD-cards awesome sanity-saver for wait/returns bought with giftcard from xmas! I heart you!), but I can't play videos from itunes. So my glorious plot of having a little case of SD cards loaded with NCIS and Dexter and Bullshit is slightly more difficult to come to fruition. but it will. anyway.))

in a completely unrelated note...uh...they've apparently removed the restrictions on the various amazons.

there's....too many of them!

2009-03-14T14:10:00.001-07:00

Coraline Good.
3D glasses + Marit Glasses = Bad.
Eyes Hurty.

why, why, why is the gravitational force exerted by flat surfaces greater than the gravitational force exerted by the homes of the various objects that accumulate on them?

whimper.

I wish I played piano better...

2009-03-12T21:40:00.000-07:00

...just so I could play this song every so often.

sad. youtube fails me. I can't get the AWESOME drum jam. Go buy Highland Cathedral and listen to track 6. preferably super loud with the windows down and the sunroof open. bonus points if it's january in Minnesota. Hi Mom!

looks like someone didn't get the memo about dress code. shame, euph, shame. shaaame.

ok, now imagine this, but with the Empire Brass and Mr Kuhlman on the organ. you need to crank and drop the windows on this one too. ok, so THIS will open it in iTunes if you have it. it's a preview.

...Steph and Patrick and Casey and I need to get together and brass it up someday. soon.

pokey claws and halitosis are no match for a good blaster at your side.

2009-03-10T18:57:00.001-07:00

I think this is Ray's cat.

either way, it's still pretty awesome. and much less terrifying than Chuck Norris as President of Texas.

sigh.

2009-03-09T08:14:00.000-07:00

yeah. today's gonna be awesome. I can tell.

mea culpa.

2009-03-08T22:28:00.000-07:00

Hey, California? We may have kind of gotten off on the wrong foot, here. I may have judged you too harshly. Certain words may have been exchanged. (Certain...bullets.) In my defense, your lack of seasons (two months of rain doesn't count) and the myrmidion hordes are fairly major points, but....I may have to take it all back.

because I just bought this at Target.

At Target. TARGET.

I couldn't find a clip of the pilot with the pertinent quote above, but this is always appropriate:

also, this made me laugh pretty hard. (but, um, sweetheart? you're pushing your low end. pick a higher harmony. tuning is your frieeeeeeeend.)

Hey. Idea. (actual economists, you should probably look away. this'll make you twitch.)

2009-03-07T16:44:00.001-08:00

How's about instead of trying to figure out stupid economic stimulus CRAP packages and fighting over OMG SOCIALIST ACK and UGH INBRED OSTRICHES, listen to this:

how much student loan do you have left? The Boy and I have a cubic shitload. a metric fuckton. a. lot. of. debt. I'm betting we're not the only ones. here's my economic stimulus package: Forgive it. Hell, even keep it, but just make it interest-free. I understand that part of the problem is bad things the banks etc have to deal with...but isn't that why the whole refinancing thing is legal? some money is better than no money? And I don't pretend to be an economist. at all. I'm sure my thoughts and angry mutterings have very logical, perfectly reasonable reasons why things are the way they are, or why it can't change to the ways suggested. I try to educate myself more about economics but seriously: I tried listening to two economists and bill maher last night and couldn't stay awake. or concentrate. after 5 minutes. and that's with bill's annoying-entertaining commentary.

but $716.62 dollars a month is $8,599.44 a year. that is a lot of cash. That's a lot of money that could be going into our local community. into our savings. into better health insurance than the crap I get from work. (and yeah, how ironic is it that an EMS company gives its employees crap insurance? ok, so not many people rely on the ridiculous eye coverage that I do, but still.) maybe you've got less. maybe it's only 500 a month. that's still 6,000 dollars. and how many students graduate with that amount of debt each year? 8 million? (8,666,000 attended a 4 year school in 2006, according to NCES,) even if only half of them have debt, and it's baby debt- say 200/mo- that's 9.6 billion dollars. 24 billion dollars if they've got a 500/mo payment. in one year. it'll take us 10 years to pay off everything assuming the interest doesn't change. say it only takes 6 years to pay off the baby debt. 57.6 billion dollars (over 6 years), all paid by those hypothetical 4 million graduates. I know that's a drop in the bucket to the government, but still.

because I'm not awake yet.

2009-03-07T11:27:00.000-08:00

1. YOUR ROCK STAR NAME (first pet, current car): Loki Xterra.

2.YOUR GANGSTA NAME (fave ice cream, favorite type of shoe): Dad's Homemade Vanilla Flip-flop.

3. YOUR NATIVE AMERICAN NAME (favorite color, favorite animal): Cobalt Polar Bear

4. YOUR SOAP OPERA NAME (middle name, city where you were born): Freya La Crosse

5. YOUR STAR WARS NAME (first 3 letters of your last name, first 2 of first): Polma

6. SUPERHERO NAME (2nd favorite color, favorite drink, add THE): The Burgundy Mojito

7. NASCAR NAME (the first names of your grandfathers): Olin Jack

8. STRIPPER NAME ( the name of your favorite perfume/cologne/scent): Schroedinger's Cat

9. TV WEATHER ANCHOR NAME (your 5th grade teacher’s last name, a major city that starts with the same letter): Dvorak Denver

11. SPY NAME: (your favorite season/holiday, flower): Fall Lilac

12. CARTOON NAME: (favorite fruit, article of clothing you’re wearing right now): Mckintosh Apple Pullover

13. HIPPIE NAME: (What you ate for breakfast, your favorite tree): Yaourti me Meli Birch

do you really wanna catch us

2009-03-05T20:18:00.000-08:00

oh do you really wanna get on that bu-us?

after a ridiculous few days at work, the best medicine? seeing huge moon rings and watching a cat play with an empty cardboard fridge-pak box. who knew that barq's (tried to spell that barques) held such feline allure?

also: currently topping the lists of "songs not to have in your head during rush hour in the am-ba-laince and your partner would not appreciate you singing:"

this one too.

and I <3 this chord. you know the one I'm talking about. right at 1:13.

(yes. that is murder she wrote.)
oh, man, am I having a ridiculous flashback to senior year. DAN! KEEP YOUR DAMN BLADE UP! JOHN! FEET! away away, my butt's on fire, cause I've been sitting on it all damn day... Kate, you so should have been Mabel when Luther did it. you rocked that madness.

shame. shaaaaame.

2009-03-04T21:08:00.001-08:00

I am being a horrible swapper. but it's not my fault! I had my princess bride package all done and ready to send, all it needed was postage and delivery confirmation before starting its happy meandering way to its recipient.

then Friday From Hell (fuckyouverymuchdispatch) happened. and I've been carrying it around ever since. Tried to give it to The Boy to mail...then reconsidered. mmm...no. Also carried a moleskine around today that was going to get mailed...sigh...This whole working 9-5 thing is getting mildly annoying. anyone know if I can get delivery confirmation online? I have a scale, I can figure out how much postage I need...

got my princess bride package! will have a photo up tomorrow. miracle pills (chocolate coated, ocourse), a moebius felted purse, bangles, wax lips, and a ginormous squishy packet of bluefaced leischowever you spell it-SQUISHY WOOL GOODNESS-ter fiber. muahahaha. I heart you partner. heart heart heart.

still no news on the Igor front. USPS says my package made it to its destination, but haven't heard yet if it did. she said she was pretty busy when we last 'spoke' so hopefully that's all that happened. (thanks, UPS guy, for leaving my package from Mom^2 at my old doorstop on market street in oakland...yeah...good call.) especially considering you can't GET to my doorstop without calling me to buzz you in...

teryaki pork tenderloin in hotbox. the thing. you know. oven! that's the word. made onigiri for lunch but got seduced by bakesale betty's fried chicken sammich and freshbaked brownie and nummy nummy lemonade freeze (just like golden valley poolside! only in a lot smaller cup, sadly.) and only 5 dollars because bakesale betty's hearts the EMS. which is why we heart bakesale betty's. even if me and my monday partner forget every monday that they're closed until we've driven over there. sigh. anyway. actually got an onigiri mold when I bought my bento box (LOVE OMG LOVE) and man is it so much easier to make onigiri with actual, y'know, tools. as opposed to sticky fingers and saran wrap and measuring cups.

Ants! on my desk! dammit they're everywhere! I canna take it anymore cap'n!

but I digress. sorry. off to go beg forgiveness of my swapee.

ok, one more digression. Why Marit Learned To Close Her Laptop When She's Not Using It. comes home, wiggles mouse, this window appears. Thanks, Jayne. Don't think I'm not watching you and your nefarious kitten campaigns.

I love my planet.

2009-03-01T22:44:00.000-08:00

did I already post this here? I don't remember. it bears repeating, though.

but do yourself a favor and don't read the youtube comments.

also, shopping for boots sucks and sleepy hollow is (for the moment) The Best Movie Ever. mrowr.

pbbbbththth.

2009-02-28T16:43:00.001-08:00

yeah, well, I hate you too, yeast.

boller fail. on to aunt andrena's cookies. gado-gado should be fine.

channeling Samuel Jackson...

2009-02-27T20:47:00.000-08:00

... as in I've had it with these motherfucking snakes on this motherfucking plane, only change snakes to dispatchers and plane to day.

05bumbleyuck: The Boy's alarm goes off. Marit grumbles and rolls over to this:

more animals
yeah. no. evicts kittehs from room and rolls back over.
0815: wake up. realized managed to somehow sleep completely through alarm. crap.
0825: pulling on boots and zipper breaks. attempt to fix.
0842: look at clock, realize it's 0842, swear profusely, give up on boot, bike to work.
0855: race train into work. clock in. go change.
09ish: dispatch tells us our first call is at 1030. marit goes to put contacts in, tame The Hair of Poofy Death, and try to forage for food. hey, someone brought muffins. sweet. eats half of a chocolate muffin. mmm, muffin. also sutures boot closed on foot with paperclips.
1000: head to call.
1005: go "WTF!?" at traffic. seriously? at 1005? stop and go? what?
1030: arrive at call in oakland, having lost chance at coffee. oh well. there will be later chances. (HAH) while at call, get dispatched to a new call, pickup in alameda at 1215.
1200: arrive in alameda, swing past a starbucks (me) and McDeath (tim) because- cue ominous music- we'll be able to grab real food in berkeley after this.
1215: pick up in alameda, drive back to downtown oakland.
1300: drop off patient and get another page, this time a pickup at 1330 at the location we just dropped off at, going to berkeley. we decide to just hang out, since there's not really any food close.
1310: someone comes out to tell us that our 1330 is ready now. ok, let's go.
1400: drop off, get another page, pickup in san pablo at 1430, oh, and by the way, it's an emergency call. we tell dispatch we still haven't gotten any food and we're getting cranky and need food. they say fine, after this call we can get food.
1435: pick up patient, get clear at 1500. realize that dispatch has given us a call at 1600 going from San Ramon to Fairfield. SAN RAMON TO FAIRFIELD. FAIR.FIELD. get cranky at dispatch. "uh, we still haven't gotten a bite to eat. since 0900. any chance we can get a closer 1600?" dispatch: "uh, I really need you guys up in coco county, so, go ahead and grab something on your way there." yeah. like it's not going to take us an hour to get to fucking San Ramon from San Pablo at four-o-fucking-clock.
1602: arrive at san ramon. pick up patient. drive to fairfield.
1630: get phone call from schedulers. can you work tomorrow 0900-1700? do the O.o stare. (remember? the omgwtfbbq stare? the Friendly Hostility Fatima's WHAT stare?) send charlie and mandy and matt texts to see when/if bbq is happening tomorrow. get back "...who is this?" texts from charlie and mandy. send "marit." texts. get "oh! AWESOMENESS IS HAPPENING AT 1800. WOO" texts. grumble at perkiness. weigh $ and possibly getting a day off next week vs likelyhood of having another DAY OF DEATH, call schedulers. "oh, wonderful, you called us back, sorry about the phone issues, (they could hear me, I couldn't hear them), thank you so much, but we just filled the hole, have a good day!" urge to kill rising. no, don't kill the schedulers, the schedulers are your friends. good schedulers. *petpet.* sigh in relief at dodged bullet, then try to rein in urge to flip on the primaries and sirens and MAKE THESE IDIOTS GET OUT OF MY WAY. holy mother of god is traffic RI. DIC. U. LOS. on a friday in this state.
1835: arrive in fairfield, drop off patient. 2 hours and 35 minutes of no contact with dispatch. what's supposed to happen? they call us after 45 minutes of no contact and make sure we're not dead in a ditch somewhere. screw this, we're going to go eat. and sit down and eat. we go to in and out.
1900: have first actual food since half a croissant at noon.
1945: get back to station. send in paperwork.
2000: clock out. YAY FOR 11 HOUR SHIFTS. NOT.

here is a map of my day:

thank you dispatch. you have made me cranky. and I mean cran.ky.
AND I HAVE NO BEER. but I have rum. rum and rodrigo y gabriela and smashy smashy video games and fuzzy kittehs and eventually I will become noncranky. but for now I am not opening my mouth because The Evil Marmot has the reins.

My name is Marit, and I approve this message.

2009-02-25T19:44:00.000-08:00

drool.

and they're currently working on a new album. faint.

I-I was weak.

2009-02-21T17:38:00.000-08:00

yes, there is a Firefly quote for every occasion.

But it's true. I was going to be strong and not go buy Bone Crossed or Whisper to the Sleep but really, if I hadn't gone to get them, instead of spending five hours curled up in a Starbucks sortof-comfy-chair reading while nursing a cinnamon dolce latte, you'd be reading about the aftermath of a murderous rampage through downtown Oakland.

yes. five hours.

I was curiously disappointed with the new Dana Stabenow, but I think it's because I think I downed it like an Irish Carbomb and, while it left a good aftertaste, it wasn't as good as if you'd slowly drank the whole pint.

ok, so as a metaphor it didn't work so well, but if you love guinness and you've ever done a carbomb, you should understand it. Brittany and Anna get it. At least I think it was you two. Lord, that sounds horrible. I can't remember due to crappy memory, not drunken debauchery. Honest. I'm pretty sure I did the same thing with Small Favor, so a reread will be in order. See, authors? this is why you should write faster. *snort.*

must....resist....urge....

2009-02-20T19:28:00.001-08:00

So I spotted the newest Mercy Thompson (protagonist) book out as I was picking up The Boy's valentines day present (which was a book on astrophysics). I resisted the urge to purchase. I'm still trying to track down a library in my area that I can actually get to and isn't in sketchy parts of richmond. (hah.) and I am being virtuous and not purchasing unnecessary things. (although I need to go pick up a bottle of cinnamon dolce syrup so I can better resist the siren song of the cinnamon dolce latte. mmm. well, the siren song of the coffee shop, I guess, not the latte itself.)

BUT.

I was checking my release dates and just went ZOHMYGOD (illustrated here by Friendly Hostility (which is an awesome webcomic (that's ending soon snif) but you should go read it anyway):)
(those faces in the beginning are the pertinent part. also, I heart Fatima.)

...because the newest Kate Shugak novel of Dana Stabenow's came out on the 17th of FEBRUARY and oh my god I want to go to a barnes and noble RIGHT NOW. RIGHT. NOW.

soooooo much. I totally could too. There's one right there. right down the street. and I have to be at the car dealership tomorrow by 0800 to give them my car so that they can check it and fix it and a book would totally be required to ease my pain, right? right? RIGHT?

do I get to amortize cost based on sanity? mom?

heh, I just realized that using a comic with Fatima to illustrate a point about that book is actually pretty apt, given that Kate is a cranky alaskan and Fatima is cranky and in alaska. oh, go read the comic already.

hoo-ray!

2009-02-19T18:26:00.000-08:00

well, it was a good thing I packed my lunch today because dispatch sent us driving all over- and I do mean ALL OVER- the bay area. about the only place we didn't hit was the true north bay. it seemed like every time we talked to them it was "you can show us clear from *insert place here* and enroute to *insert place here*" and we would gaze longingly at various places as we drove past them. "look....it's that really good shaved ice place..." "...oo, that place has great burritos..." "...starbucks/peet's/tully's/coffee...sigh..."

But! got off mostly on time (stupid traffic I hate you die) and I got home in time to get online to get one of these before they all disappeared! for a good cause and the most awesome discworldy thing in a long time. space! and hawksbills! and discworld!

sent of my igor package to itth dethtination yethterday. was going to send off my section of the latest Dr Who scarf today but see aforementioned 'running all over the bay area' y'know? tomorrow.

ugh and the car gets to go for a checkup saturday at 0800 ICK which means I probably won't be making my noon appointment at origins, sad. grumblybrumgle.

Ssssh! Cow on wall speak!

also? this should not have made me laugh as hard as it did...but it did.

LIES! *snicker*

I want you to know that I intend this breast satirically.

2009-02-17T20:09:00.000-08:00

So I didn't find my navneskilt in time to take a picture on nametag day, but I just went and voted for my pics. Tried to keep with the skog faith, but got suckered in by two girl low brass-ers. C'mon. I can't not vote for the euph! or the trombonist in the tree! gotta represent!

whimper

2009-02-13T20:01:00.000-08:00

I can't find a clip for this. YouTube failed me. Gone in 60 Seconds:

"You can't negotiate turns. You can't signal properly. You can't maintain speed. You can't parallel park. Hell, you can't drive honey. Shit, I can't swim. I know I can't. So you know what I do? I stay my black ass outta the pool."

CALIFORNIA: please, please please learn how to merge. or stay outta the pool.

Also...Dispatch: please familiarize yourself with the terms 'rush hour' and the geography of the East Bay. seeeeeriously.

I'm buying stock in Windex.

2009-02-12T19:54:00.001-08:00

eff-yoo-cee-kay-tee-aitch-aye-ess. lefuck lethis. uck-fay is-thay.

Fuck. This. Shit.

I'm moving to Alaska. or back to Alta. I'll go chill with that swedish chick with the fire-engine red, butt-length dreads and her sheep farm and penchant for folk dancing, or go back and tell Marit Sara or Sara Sara or Sara Marit or Marit Eira that yes, I would love to meet their grandson/nephew/son/sister's cousin's brother's uncle's grandson, and I'll use him to get my norwegian citizenship, then get The Boy his citizenship, and he won't care, because we won't have to deal with the fucking ants of doom.

for fuck's sake.* we've sanitized. we've scrubbed. we've gone through enough windex to clean every window in the city. we've tupperwared the shit out of our kitchen. still they come, now in my bathroom (which does not share an outside wall.) and under the dishwasher (which is CENTERED INSIDE THE APARTMENT.) and along my desk, and in the relocated cat food, which has now been re-relocated outside. I guess we have to go back to "hey. hey. hey. hey. hey. hey. hey, human. hey. hey, human. human? human, I want food. now. hey. hey. hey. hey. hey. hey, human. hey. HEY. FEED ME, SEYMOUR." although I want to ship the cats over to charlie and mandy's or elliot's or steph's and terro-bomb the hell out of the apartment. and then call the landlord and say "the ants. get them out of the walls. I'm not paying for it. if you won't get them out of the walls, then I will. you do not want this." but that's not gonna happen.

*and yes, that is the sole phrase that I say with a deep minnesotan accent. (usually with an oh in front of it. yes, 'oh, fer feuk's seyk.') I say it rarely. the last time I said it, I made my partner spit coffee all over the rig. no, that isn't hyperbole.

snort.

2009-02-06T21:46:00.000-08:00

Topping the list of "Headlines That Make You Go ...What?":

Putin denies dancing to Abba hits

Hokay.

2009-02-05T20:23:00.000-08:00

Ok, universe. I submitted my timecard for this past friday-thursday, which means that this whole recent "let's rain hellfire on marit" thing that you've got going on? Is done. done, over, no more, we're going to have a good day tomorrow, yeah?

otherwise, I will not be held responsible for my actions.

(it's a tossup between screaming murderous rampage and rocking in the corner sucking my thumb.)

Monday: everything goes OK until we get a call for pickup an hour and 45 minutes before we're supposed to go off duty. Our station's in Richmond. pickup was in Vallejo. dropoff was in Sonoma. ookaaay...we can almost make that. (my thought? dispatch's sense of scale is a leetle broken.) also? dispatch neglected to inform us that I was going to be spending 45 minutes in the back with a very annoyed, very...vocal patient. get back to the station 2 hours later than we should have.

Tuesday: marit forgets to set her alarm back to the 0900 start from the 1000 start from yesterday. bother. get to work, change, stick contacts in eyes, walk out. hmm...no partner. call dispatch. who's on first, what's on second, I don't know THIRD BASE ensues. Marit's partner is now station manager, who is training crews and will return later. kay. station manager returns. station manager tells marit that shift has been cancelled and marit should go home. Marit's first thought: yay, now I can do the chores and clean the freakin' fish tank like I've been meaning to. Marit's second thought: waitaminnit. I just got screwed out of 6 hours of work through no fault of my own. Marit's third thought: dammit.

Wednesday: is hereby renamed "aaaawwwkwaaaaaard" day. you can insert your own image of Johnny making the sign for awkward.

Thursday: can I indulge in some internet-speak? omfgwtfbbq. srsly. o.O -_- ... ok, done. shift starts 0815. we have the 'special' radio that gets everyone else's pages, and almost none of our own. case in point? we're posted up in berkeley, 1100 rolls around, and dispatch clicks in and says "uh...you guys on scene yet?" um, let me think. NO. we look at the radio. no page. we'd talked to dispatch around 1000 and they'd said nothing pending. well, apparently we'd been given a call with a 1100 pickup. (and dispatch apparently decided that they'd wait until we were supposed to be on scene before calling to check in, as opposed to, y'know, calling in 15 minutes before to say "hey guys, you en route to your 1100 yet?" so that we could have, oh, say, gotten to the call on time?!) (and then they called us -twice- with our ETA. yo. dispatch. I'm two fucking blocks away, when I'm on scene, I will call you that I am on scene. do. not. ask. me. every. five. minutes.) I know, I know, if I am nice to dispatch, dispatch will be nice to me. mutter mutter they started it mutter. but the patient is very nice and we move on to our next call, which went so wrong that I have blocked it from my memory and rewritten it forcibly with vanilla vodka. (just a shot, and I poured it into my coffee after I got home, don't worry.) I also can't really make it vague enough to satisfy hippa soooo there ya go. It was......bad. not the patient, who was also very nice, and about the only good thing about that whole...what was I talking about?

huh? oo, shiny....

Anyway. Tomorrow = new day, new payroll week, thus I implore you, o universe...throw me a bone, here.

Also, I got a catalog today from the Lindblad national geographic cruise thing people. And this?

Oh. My. God. although I want my grandpa as tour guide again. just look at it. waaaaaaant. oh, to have thirty thousand dollars to spare. if I had 30,000 $...I would sigh wistfully at that map and wish I had another 30,000 $.

The kittens are being ridiculously cute. This probably means they've found a skein of silk laceweight and have turned it into amigurumi hair.

Neil Patrick Harris is on Craig Ferguson every night this week for Magic Week. I love him.

2009-01-27T08:33:00.000-08:00

I have two patches of relatively itchy could-be-spider-bite-could-be-mosquito-bite-damn-well-better-not-be-hives on my elbows.

stupid random monterey allergy BETTER not be coming back.

the face....it's coming from the faaaace....!!!

2009-01-24T11:30:00.000-08:00

best. movie. ever.

enjoy this, because I'm fighting off another wave of ants. siiiigh. later, I will tell you of the Day That Didn't End Well.

also...brain...so...hurty...so...hurty...

mmm...wife soup.

2009-01-20T20:57:00.001-08:00

not really. just keeping in line with the firefly of earlier.

Sad Panda: nighttime theraflu's honey lemon and chamomile flavor is NASTY. na-stai.

Happy Panda: I have egg drop soup. is not Mom2 soup, and is from a packet, but is egg drop soup and good and nummy and hopefully de-coldifying.

Sad Panda: NCIS tonight is a repeat, and not new. saaaad.

Happy Panda: at least it's the episode with Ziva as a lounge singer in a ridiculously hot dress. Shallow? Moi?

although I do wish that they'd gone with a high neckline, like what'serbutt's dress at that award show that one time. I know. So specific. The chick from Boys Don't Cry. You know.

mrglmrglmrgl.

2009-01-20T19:15:00.000-08:00

0600: The Boy goes to work. The Thing...It Liiiives! rolls over and takes 2 Nighttime Sudafed, then goes back to sleep.

0830: Alarm beeps. The Thing...It Liiiives! grumbles, but pokes it into submission and staggers to couch for to feed and watch an hour or so of inauguration. that's a really hard word to spell on cold pills. seriously. Anyway. Stupid CNN Announcer Guy! NO ONE cares that at 1200 Obama became president even though he hadn't been sworn in. NO TALKY OVER PRETTY MUSIC! seriously. the cats were confused as I was shouting shut up shutupshutup at the tv. grr. he's going to the special hell. (see 01:33, and then just watch the whole episode, because firefly=win.)

1030: The Thing....It Goes Back To Bed. (after taking more nighttime sudafed.)

1500ish: The Boy returns. The Thing...It Liiives... takes an Advil Cold and Sinus so as to actually be able to accomplish things and not pass out again. The nighttime sudafed packs a punch, it does. The Thing...It Liives... realizes that being conscious = being zombie, because eyes hurt, teeth hurt, all sinuses plugged, lips chapped, drugs not working must kill everything. especially The Altogether Too Chipper Boy. dishes go out of dishwasher. go lie down. Dishes go in dishwasher. go lie down. cat boxes get cleaned. no creature that small should ever be able to produce that much shit. seriously. contemplate calling in sick tomorrow too. check schedule. money...sleep...money...sleep...money...sleep...damn you, student loans...

Undiscovered time: Decide that sleep trumps money. Go to call in sick. Look at clock on phone. hellfire and damnation, it's 1708. if I call in sick now, I get tomorrow and thursday off. The Boy says something to the effect of how he feels much better today. contemplate killing and eating The Boy's brain. mrglmrglmrgl. back hurts from sleeping so long. ignoring fact that going from freezing-roasting-freezing means fever. what? what's that? nothing. draft = cold, too close to heater = hot. yeah. that's it. throw clothes in laundry. make russian tea. mmm, russian tea. want time to bend and have Mom 2 magically appear with The Life Giving Mom Soup. contemplate making egg drop soup.

1944: gather strength for making egg drop soup. in 16 minutes can take more drugs. also NCIS on. hopefully will feel better tomorrow. or hope for slow day tomorrow. yah.

Jack Black as Jesus. oh dear.

2009-01-10T15:22:00.000-08:00

Although any mention of Prop 8 still makes me want to give up and run away, this is still pretty funny. I heart Neil Patrick Harris.

"Prop 8 - The Musical" starring Jack Black, John C. Reilly, and many more... by Jack Black

let's hope for another day in The Sunny North Bay, ok?

2009-01-08T20:07:00.001-08:00

because the longer I can stay out of the Oakland area in my shiny navy blue uniform with shoulder patches and name tag, the happier I'll be. I don't look like a cop if you actually LOOK at me, but people don't LOOK at anything. (case in point? this guy yelled at me in a mall because I didn't know where Taco Bell was. I went "um...I'm an EMT? I don't work here..." and he flounced off muttering about bad service.)

this is why. (Mom, don't look.)

Hey. You.

2008-12-31T15:36:00.000-08:00

People.

If you're in an avalanche because you went under safe conditions and had beacons and training and weren't doing stupid shit, but die anyway, it's not your fault.
-but-
if you're in an avalanche because you went under unsafe conditions and didn't have a beacon and you were highmarking and doing other stupid shit, and you die because you turn back into the avalanche to try to find a friend before the slide has stopped, then you have not died a hero. you've died an idiot, and have endangered the lives of the people who are now trying to save your ass.

Learn. Your. Shit.

thus endeth the day's rant.

fæææææææææææn.

2008-12-29T21:30:00.000-08:00

(for those of you not in the know, that's a very naughty word, held out for one leeengthy syllable, which means The Marmot is unhappy.)

So I finished my training on Thursday the 18th and called the schedulers on Friday the 19th to let them know I could be scheduled, but all over break when I checked to see when I'd be working, nothing was marked. blank calendar. I called yesterday and they apparently didn't get the message that I'd already called, despite me actually talking to a live person.
This afternoon around 1300 or so I checked and had a shift for Wednesday the 31st. Yay, I get to make money and feed the anemic bank account.
Tonight I check it (we're supposed to check after 1900 in case they change it on us) and Lo and Behold....

I work at 0400 tomorrow.

oh dear GOD IN HEAVEN. fæn. fæn fæn fæn. That means I have to be up at 0300, and it is 2137. FÆN.

whoever is sick and making me cover your shift? you'd better be in the ER.

exactly what I needed today.

2008-12-22T18:04:00.001-08:00

from the incomparable Randall Munroe:

...we'll think about it.

ok, now it's christmas.

2008-12-21T13:41:00.000-08:00

I have a wee little solar light string on the trellis that the passionflower vine inhabits, I am baking cookies, and (and here is the pertinent part) I am listening to mannheim steamroller. I would have a real tree, but a) little apartment and b) ginormous cats. (although I was tempted to stop by and get a little baby one when I had the truck on Friday.) Once The Boy and I get home from MI we'll put up the little fake tree we have. There's no snow, but we can't have everything, can we.

Going to meet Ebet and Thomas and mebbe Alexis in the city later for some...something. we don't know what.

also:

two things...how much do their neighbours hate them, and what is their power bill?

and of course:

Howodd Bensonmum.

2008-12-20T10:52:00.000-08:00

So I passed my field training and am now obsessively checking the crewscheduler to see if my shifts have been assigned yet. They probably won't be until after I get home from MI, because I think that's what they said when I called, but I'm not sure.

went to go get my YOU MUST SEE ME bike gear (having learned that although my winter shell is nice and waterproof and toasty and bright red, it is also invisible enough in the morning at 0700 when I try to bike across the intersection for minivans to pretend I don't exist and try to hit me. and then gesticulate at me for daring to follow the 4 way stop rules.) Also, my bike home at night is fine because there's almost no traffic, but since it's through an industrial park, there's also almost no lighting. is dark. So I reserved a car (first for wednesday, and then The Migrane Of Doom ate my face, so I changed to friday), -enterprise lost my reservation, but had a chevy silverado they could rent me for the same rate as the intended car (that's not a truck, by the way, it's a boat. seriously.)- and drove up to the Vacaville outlet stores, where, after much meandering, following mapquest directions, abandoning mapquest directions, swearing, getting distracted by stores I wanted to go to (but yea, verily, I was virtuous and only got sidetracked by the RHCF...er....RMCF...rocky mountain chocolate factory, which gets called the rocky horror chocolate factory, because...it just does. It has amaaaaazing chocolates and smells like skiing and winter and warming up from cold and hot wax and skiboots and snowbird plaza, which is mountain air and snow and grillsmoke and propane and gore-tex and sweat. The woman behind the counter gave me an odd look because I spent a good 5 minutes just smelling the store. I did also go to the bath and body works store because I needed some christmas presents for MI that don't involve yarn, because I have a scarily small amount of hours left in which to finish said yarn-involving projects. yeep. but I was vigilant and did not go to the papyrus outlet or any of the others that made me go ...hey... as I drove past in search of the Pearl Izumi store.) I made it to the Pearl Izumi outlet, which was in fact on the other side of the freeway. bugger.

and I got my rain high vis jacket and glubs and a headband that actually fits under the helmet and a high vis long sleeved shirt for when it's too hot to wear the fuzzy windproof one I got when I was living in Norway and then hightailed it back to Richmond to return the car before 1800.

The Boy asked me why I spent the money to rent a car when I could have just gone on Saturday. Because, I said, what is the trifecta of "Stay Away From Shopping?"
1). Saturday.
2). December 20.
3). Giant outlet-sale mall-thing.

He did not look impressed. Clearly he never did the "oh, crud. we have to go to Ridgedale to get x/because we forgot y/z finally came in. ok. here's the plan. we will park in the waaaaay back. head down, shoulders up, protect all vital areas, get in, get out, then flee and lock self in house" game. (it's even more fun when you realize you have to go to southdale. or the galleria. or *gasp* the MoA.)

Anyway. Now it's off to get a tiny bit of groceries, then a replacement for the kitty tower (which Teh Kittehz have already tried their damndest to destroy, and it shows, and is possibly no longer entirely stable), and then home for chores. Also have to get keys to Steph and find out when on Sunday Ebet is going to be up here so I can go harass her and when on Sunday I can go harass ALEXIS who is in town and if I don't get a chance to see her I might implode because I haven't seen her in for-eeeever, so to set all this up I'm going to go away now.

What?

Oh, you're confused about the title? (well, Mom isn't. hi mum.)

Sir Alec Guinness. (Luuuke...)
Peter Falk. (...oh, just one more thing, Mrs C...)
Eileen Brennan. (yes, you know her. Mrs Peacock? uh-huh.)
Peter Sellers. (you'd better know him.)
David Niven.*
Truman Capote.*
Maggie Smith.*
James Coco.*
*(you know all these guys. they're the ones that make you squint at the screen and go "...I know you...I do...you're...uh...who are you!?")

All in a movie together. Said movie is spoofing the great literary mystery main characters; Miss Marple, Sam Spade, Nick and Nora, Hercule Poirot...

There is absolutely no reason why you should not go out right now and go rent Murder By Death.

No. Reason.

well. unless you own it. that's a reason.

tempvsfvgit

2008-12-13T23:12:00.000-08:00

yep, that it does. that. it. does.

I'm in an odd mood, because I have had this song stuck in my head all day. aaaall day.

you know what that does to you? it makes your brain goo out your ears.

no, wait, that's watching the same flash videos over and over and over andoverandoveranoveranveranveravnererererer because insurance company-ese is evil and needs to die. especially ThomCo.

case in point? here is a snippet of flash video: "before entering the intersection, you should look left, ahead, right, then left again."
here is a snippet of test: "True or False: before entering the intersection, you should look left, right, and left again."

that'd be false, because for some reason they've decided that when you move your head from left to right, you close your eyes to avoid looking directly ahead. and now, it's obvious, but when you're taking the test you go oh, that's true, and move on, and try to figure out if they're doing something similar with the yelp time (turn siren to yelp at 150 feet...so when the question asks 'your siren should be changed to yelp mode at 100 feet"...do they mean it should already have been changed? curse you english and your lack of clarifying verb tenses!!

and osv. get it wrong, or otherwise fail to get a perfect score, and you get to go back to the beginning of the unit and watch everything. over. again.

and your brain turns to goo. and then you giggle really, really, really, really far more than you should when you find this video while searching for a better clip than the one above.

owies.

2008-12-10T11:10:00.000-08:00

I think Jayne is trying to kill me.

last night my hair was once again in DagmarFro mode, which is one reason why very time someone tells me to try X shampoo or Y conditioner to fix my pseudo-dandruff dry scalp crap (that I think is really just my Stupid Face Crap on my scalp, because the medicated dandruff shampoos just make me go ohgodgetitoffitburnsgetitoffgetitoff), I have to restrain a laugh. Especially when it's a high moisture body boosting shampoo or conditioner. do you want to be spoinked off the planet when my hair explodes? no? This is what my hair does with any volume increasing agent, including a hair dryer:yeah. When two of us had to be trolls for a dagensprogram at The Skog, my compatriot spent 30 minutes teasing her hair out into a ratty poofy mop. I took 5 minutes in the shower with a trial size of Herbal Essences body and volume shampoo and conditoner set, and 15 minutes with a hair dryer, and my hair was way trollier. it also took two days to go back to normal, and during those two days I broke two hair elastics pulling it back into a ponytail. Hair. Of. Doom.
(Way back in high school Deoni offered to braid some cornrows into my hair to stop me whining about how my fencing mask fit until she actually started playing with my hair. Then she said if I wanted them I had to submit to Torture By Gramma. My hair is mutant. Every place I've gone to get it cut has classified it differently- fine, but a cubic shitload of it; thick, but normal amounts; coarse, but normal amounts; a mix of both fine, straight hair and rough-but-not-coarse curly hair, in just above normal amounts. I think the last is probably closest, because my hair goes curly in humidity but is pretty straight otherwise, and I have halo hairs that are very fine but I also have hairs that are freakin' huge and creased, and I know I have more hair than I should because every time I've gone to get my hair dyed by someone new, they have to go back and mix more color at least once, and they're always surprised. Anyway. got distracted by hair rant, which is now ending. ...I need a haircut. sorry. done.)

So. I'm petting Raz, who is curled up in his throne/perch/tower, and Jayne is chewing on the tower (carpet fluff is apparently The Best Thing Ever), and all is well and shiny until he notices that my halo of frizz is taunting him, and he swats for it at the exact moment that I turn my head, so I get smacked in the face with stabbity kitten claws. (Jayne has also not yet learned to play with Teh Hoomans with retracted claws.) he drew first blood! ok, so it was a miniscule droplet, from a miniscule iinsey wiinsy scritch, and is invisible today (and indeed, invisible within an hour), but still. Matt squirted him with water, but I'm not convinced that he actually connects water squirt with disciplinary action.

And this morning, I'm trying to drag myself out of bed, and he steps on my eye! (our cats have this obsession with our water glasses on the headboard, because clearly, the water in their circulating fountain dome thing is contaminated Sixth Sense style.) yes, we have The Most Ridiculously Spoilt Cats Ever, although a case could be made for less 'spoil the cats' and more 'lazy-arsed humans who like having to refill the food dispenser every other week and the water dispenser once a week because scooping out poo is bad enough.' (our cats break all laws of matter conservation. seriously. nothing that small should be able to produce that much waste.)

see? totally trying to kill me.

he also apparently sleeps on my chest, and sometimes Matt shoves him off because he's sprawled basically on my neck, but since the below clip shows you what must happen for me to wake up, I can't vouch for that.

crazy time, part 2.

2008-12-06T22:59:00.000-08:00

So The Boy is in the habit of torturing the cats. (every time I write torturing my fingers want to write Tortuga, and go watch pirates of the carribean. I am also totally and completely braindead from going through the FEMA incident command system crap, which may have something to do with it.)

he managed to trap Jayne in the boat a few days ago, and Jayne was fine with this until he realized he couldn't actually escape by playing the humans-poke-the-side-and-I-pounce-on-it-to-killkillkill game. at that point he started his pitiful oh-crap-I'm-going-to-the-vet-and-I'm-trapped mews. The Boy then released him.

Fast forward to tonight. I'm getting rid of the last of the Craig Ferguson shows left on the DVR and trying to finish this FEMA shit without breaking down in tears of the famed "oh my god really?" sort (don't worry, you'll see what I mean in a second.). I'm mostly tuning out the thuds, scrambles, clinks, and other various and sundry sounds that indicate the cats are in the middle of crazy time, and they're busily trying to kill each other. I hear a particularly worrisome thud, and see that the little flag at the top of the boat is no longer visible behind the couch. Not a big deal, they knock it over all the time.

but suddenly....it's quiet. Too quiet. ledere senses tingling! and at this point I hear a "...mew." I peer around the couch, and Jayne has managed to trap himself in the boat. so I grab the photo. No. I grab the camera, for to take photos. (sigh. see what you make me do, FEMA?)
Raz is coming to investigate the piteous mews. There is, however, A Giant Black Thing Right There and it might attack him, so caution must be exercised. The Giant Black Scary Thing hasn't attacked, so it's ok to venture underneath and investigate The Interloper (Jayne), although this is confusing because he can see him and he can smell him, but there's this weird blue stuff in the way...This one is with the flash, which is why Raz is sort of squinty, and is taken after Raz has carefully placed a paw right in front of Jayne's face, only to remove it and shake it. (Raz doesn't like the mesh feel. he's sort of a diva cat.)

Don't worry, I released The Kitteh from his jail after taking the pictures.

Anyway, so this FEMA crap I'm slogging through, for The Job, is a set of online courses and exams that you take to certify that you are a) not brain dead and b) speak governmentese. Why is this depressing? this screenshot:Yes, that's right. it's saying that a presidential directive requires homeland security to play well with others. As opposed to what? not coordinating with other federal depts? oh, florida just slid into the sea? oh, well, here's our plan for rescue and support and YOU CAN'T SEE IT neener neener neener go make your own?

...

...

...nevermind.

er....look!
The Stole is done!Rav has more photos.

grooooaaaannn...

2008-12-03T13:24:00.001-08:00

The Universe is talking about having sex in outer space.

They just used this phrase: "I don't think anyone has probed the idea of sex in space." and "zero-g spot."

groan.

So The Boy and I exchanged Christmas presents early because a) neither one of us wanted to haul them all the way to Michigan and then back to Caliminifornia and b) he had to go to the city to pick it up at the same time as I wanted to hit up Bazaar Bizarre.

He got me a wii fit, which neatly lays to rest my hemming and hawing about whether I wanted to get one or not. Pretty fun so far, although he's a bit miffed because my wiifit age is only 22 while his is 35. the slalom balance game is a bitch, though. hair trigger on the board made worse by the fact that you're supposed to aim through the middle of the two wickets, and...uh...too many years of racing makes me aim for the inner radius of each pair, which is not condusive to getting a good score.

it's also mildly annoying because its main method of tracking your progress is by BMI, which is the biggest crock of bullshit ever invented. wanna see why? and yes, all the forum trolls have pointed out that people know how to buy clothes to make them look their best, and that the photos aren't standardized in regards to pose, etc, etc, etc... but still. I know I'm overweight, but I am not obese, and I know that the BMI is basically crap, but it's still annoying to hear the little 'wah wah wah' sound that plays when the wiifit measures me.

bah.
This was totally my childhood.

and this is a glimpse of the cats in the middle of their crazy time, when they go running like amphetamine-dosed balls of fluff down the hallway and over the couch and unsuspecting innocent bystanders. Here we see Jayne to stage right, realizing that p=mv, and that Raz has a lot more m, and thus a lot more p, and he's screwed. you can just barely see Raz in the top stage left corner. and those little popup cubey things you see there under the couch? the kittens managed to get them there. how? see aforementioned 'crazy time.'

Because Garfield is just sometimes exactly what you need.

This is also Raz. he's a bit darker, but the facial expression and everything else? Raz.

There is a shirt available based off of the last panel of this comic, but it's not tempting enough to beat out the "Fools! I will destroy you all! ask me how!" shirt or the "Stand Back: I'm going to try science!" or the "Science: it works, bitches." shirts.

And this just makes me laugh. oh, beaker.

in which I talk in pictures.

2008-11-29T21:37:00.000-08:00

Mum sent me a care package a few days ago. it contained Hawaiian coffee for The Boy, microwave popcorn and Primeval for me, as well as some diverse candies (and comics as stuffing! yay) and these mittens, which are awesome and adorable and fuzzy and warm and now I really really really really want snow. The Kittehs also really like the mittens, as evidenced in the below photo. That's me attempting to take a photo of the mittens, and Jayne playing his favorite "sniff...sniff...KILLKILLKILL" game. I will take a better photo as soon as I lock the cats in the office. there's two cats on the backs and a fish skeleton going up the thumbs, and a little pawprint on the palm. well, pads of fingers.

This is California's way of saying "nooo, you don't want to move...you can actually grow shit here....staaaay...." my proof? Observe: Stage left, the fig that I was worried about dying, the one that didn't fruit this year, the one that only had four leaves that were getting yellowy brown spots? yeah. that's the same fig. Stage right, the tomato bush (yes, I know, they're commonly called vines, but you haven't seen my total failure of training it to the stake supporty thing. it's a bush.) below them? I took these pictures on our last rainstorm, which was....tuesday? I think? maybe wednesday. Still, it's the last week in November. I not only still have tomatos ripening on the vine.....it's still blooming. WHA?

I don't know why it's li nking.
cue craig ferguson sound clip: "I know!" The blood orange mini tree is blooming too, which makes the hummingbirds (there's two now!) very happy and drives Raz absolutely bursar. Especially when the hummingbird leaves the blossom and darts in front of the sliding door, mere inches away from Raziel's chittering, frantic face. and my camellia has bloomed! it's not yellow, like the Merritt horticultural guys thought, but hey, it bloomed! the potting soil all this stuff is in apparently came from a clover field, because I have to weed it. containers! containers should not harbor weeds. bah. let's not talk about The Giant Dandilion-Thing that I came home to growing out of the camellia pot. the kittens have been thrilled that Teh Hoomans have been home and thus able to be pounced upon, and we rewarded their insanity by moving the kitty tower from the corner by The Boy's desk to the living room. (we're hoping to avoid being woken up by their fights for supremacy by the tower thudding against the wall where our heads are, and also they will now have at least a struggle to get up on top of the desks to muck about and eat the plant.) They seem to like it, although when Raz gets scared now he runs into the office to where it used to be and blinks at the empty space in confusion.

Jayne sits on Raziel. (I like how it looks as though this silver tabby head is coming from Jayne's...I don't know what his coloration is...I had a photo of them looking like The Amazing Two Headed Cat!!! but at the moment I released the shutter Jayne decided he needed to attack the lens, so it's just blur.)
Raziel sits on Jayne. (he's actually in mid-yawn in this photo; he didn't seem to care that ginormo-kitteh was squashing him.)
And then they both get into the whole post-thanksgiving-coma thing and once again avoid death by making annoyed humans go "...aaaaw...."And that's tame for some of Raz's sleeping positions. Also? Jayne is huge. he's almost as long as Raz (and Raz is loooooong.) and his tail is a bottle brush even when he's not scared out of his mind. (and when he is scared out of his mind....yikes.) Matt thinks he's a government experimental alien attack cat that was crossbred with a raccoon, which is obviously conspiracy theorist hyperbole. Jayne has clearly gotten some lizard genes spliced in his DNA, because he's storing all his fat in his tail for leaner times, which points to some mad scientist, or to their home planet moving to stage eight of the invasion. duh.

aaah...

2008-11-28T14:37:00.001-08:00

well, the prayer stole isn't finished, because I haven't seen any lights on, nor hide nor hair of my neighbor recently, so I got fairly demoralized and thus easily distracted from my rush to finish it, and The Boy thinks that I am unavoidably addicted to the internet, but it is November the 28th and I have 'won' NaNoWriMo.

see?

bzwuh?

2008-11-24T22:46:00.000-08:00

nanowrimo + prayer stole + job searching = BOO.

just about 13000 words shy of my total. 6 days. ofuck. and I'm not even sure this is a novel. although people consider Ulysses to be a novel, so maybe there's hope.

of course, Ulysses isn't written in a horrific mishmash of english and norwegian and latin and attic greek and words that don't exist in any actual language spoken in this dimension....

but if you're interested in some hilarity, check out Ikkepedia.

bah.

2008-11-21T20:54:00.000-08:00

why must the mother sauces hate me so?

I try to make a simple freakin' carbonara (bechamel/white/whatever) and I get blobby parmesan goo. at least this time it wasn't a parmesan brick.

bah.

FINALLY.

2008-11-19T17:50:00.001-08:00

sheesh.

I am now the proud (?) owner of the little magic pink slip that is my temporary ambulance driver's license. (which is actually a certificate, and my wallet is crying now at all the shit I have to carry.) (...ok, so it's been crying for a long time, because I have all manner of random entertaining crap stuffed in there, but now the little window that usually just holds my driver's license is crying because it now holds my license, my medical examiner's certificate (which does not, despite the name, mean I am certified as a medical examiner but rather I have been examined BY a medical examiner, which is also misdirecting because a PA is not a ME. misdirecting is not the word I wanted. neither is it illusary nor distracting nor misapprehensive, all words suggested by my brain, which I think has been broken by NaNoWriMo. uh. where was I? oh. right. list of crap in wallet...) my ambulance driver's certificate, my NREMT EMT card, my Alameda County EMT certificate, and my two CPR cards. )

You think that's bad? you should see certain parts of my NaNoWriMo draft. holy freaking ouch, batman.

anyway. The Saga Of the ADL, or How I Learned To Stop Worrying and GO BUGNUTS CRAZY.

1.) Marit needs to get her Ambulance Driver's License. she is told when getting her California DL that she needs to pick up a commercial driver's license handbook and study it, then come back when employed because then the employer will pay the fee for it. ok. fine. the CDL book is horribly confusing and was clearly laid out by drunken monkeys.

2a.) All employers state that already having your ADL is either preferential, nets you more monies at start, or is required, and they also need a 10 year history printout. greeeaaaat. Marit goes to DMV.

2b.) Monday. Marit gets form to fill out and number. form is worrisome because is exactly the same form as filled out for California license. oh well. *CUE MAGIC TIME WARP* wherin Marit receives number from desk lady, walks 5 steps to bench, writes her name on form, and is told by nice man that her number just got called. Elapsed time, 2 minutes. maybe. at most. yet somehow the desk calling her number manages to spend '5 minutes' calling her number 4 times.
Not. Bloody. Likely.
Marit has to go fetch new number. Marit now gets to wait. and wait. and wait. Is beginning to realize that hm, perhaps the prayer stole was not the best choice of knitting projects to bring along to an environment that is engineered to cause hypertension. Marit waits more.

2c.) Marit's number is called! goes to designated desk, hands over paperwork, receives two printouts of driving history (and is complimented on Dr Who scarf and clean record.) on to ADL. gets sheet, pays money, gets medical history form, gets refund form because overcharged (DMV used to do livescan, but no longer), nice blonde lady sticks all my stuff in a manila folder, gives me receipt of payment and refund form, highlights where to send refund form, tells me she's back at work on wednesday so I can drop off my livescan and ME form and take my exam and bob's your uncle. turns out I don't actually need a commercial driver's license, just a certificate that I can drive an ambulance. (not even a road test, just a written test. AND you don't need to be an EMT to get your ADL, just that you get your EMT cert within a year of getting your ADL. what?) Marit is confused because watch says it's only 1315-ish, but ok, whatever. looks at cell phone. oh. it's 1540. stupid watch. Marit goes to BNN and gets coffee. mmm. coffee. shush. is on way to BART, which is on way to livescan.

2d.) Marit goes to livescan. nice livescan people tell me how to be tricksy with DMV, because apparently the DMV won't accept a livescan form unless it's their yellow copy. can't be white. must be yellow carbon copy. you keep pink. So Mr Livescan tells me go grab a form from DMV, walk outside, copy the info from his form (which is identical to DMV form), take white and pink copies, and walk back inside to give them yellow form. Mr Livescan also gives me 3 copies and only charges for 1. Marit likes Mr Livescan. see? this is what gets you repeat business.

3a.) Wednesday. Marit goes to doctor. entertaining moment of eye test: wearing glasses, have 20/20 left and 20/15 right. great. PA says to tech that they need to do an unaided exam. I can save you the trouble, I said; I can't see the wall. "oh, we have to do it anyway, it's a red box." (you must fill out all red boxes OR YOU WILL DIE). I go stand on line, take off glasses, and say "yep. sorry. can't see wall. I can barely see your hand pointing at the letters. I know the first row is E and the second is FP, but that's just because there's only so many eyecharts available and I've had glasses since the second grade. on other charts it's E then down-E and right-E, or HOTV, or Circle Heart Square, but trust me, I can't see the wall. I promise not to drive without my glasses. I promise not to walk without my glasses." They write down 20/200 (really should be 20/800, but oh well). Doc asks me if I'm up on Pap and stuff. I wince. No, I'm not, I know, I really need to come in, but Blue Cross Blue Shield of California is being evil and pretending they haven't gotten info from you guys and you guys say you haven't received their request for said info, and I can't get through their system to talk to a real person, and I'm currently uninsured. Doc blinks and says 'oh.' and knocks down the price for me. yay. see? this is what also gets you repeat business.

3b.) Thursday. Marit goes to DMV, gets number, waits. waits. waits. Learning has not occured, has not brought other knitting than prayer stole. waits. Goes cheerily up to desk when finally called. hands over livescan. Gets exam receipt and goes to take exam. passes. goes back to deliver ME form and get temporary ADL.
then the fun happens:
at the top of every page of the medical form, there is a big red box for my driver's license number, name, and SSN. right below it on page 2 there is a line (NOT in a red-must-fill-out-on-pain-of-death box) saying "Identity verified by...[] Driver's license (no:) [] other (please explain:)." the PA checked DL, but didn't write down DL number, because it's right above it and isn't IN RED. also, the vision test has three lines, like this:
Right Eye:
Left Eye:
Both Eyes:
in a red box.

Orange highlighter comes out. form gets highlighted.

DMV man: "you're missing a driver's license number here."
Me: "...it's written right above it."
DMV man: "it needs to be written here."
Me: "ok, give it to me, I'll write it in."
DMV man: "the doctor needs to write it in."
Me: "...it's not a required red box. she wrote it IN a red box, right above it."
DMV man: "it has to be filled in by the doctor."
Me: "she did fill it in. on every page. in a red box. four times. but even though it's not a required red box, I have to go back and have her write my driver's license number down, again, less than a centimeter away from where she already wrote it down."
DMV man: "you also need to have them write in the unaided vision for your right and left eyes."
Me: "the test didn't need to be performed, she wrote down for both, right there, see? 20/200."
DMV man: "it has to be done. it's a red box."
Me: "if I can't see the sign with both eyes unaided, I'm not going to be able to see the sign with either eye alone."
DMV man: "it's a red box. it's required."
Me: "Fine. give it back. I will go back to the doctor and bother her to write down my driver's license, again, and write down that I am totally and completely ridiculously blind without corrective lenses, which we already knew, and come back here. is there anything else that needs to be filled in? so that I don't have to leave and come back again?" (I totally didn't say it like that. I was able to swallow most of Teh Bitchy Marmot. most.)
DMV man: "you have to have her stamp it."
Me: "Fine. Can I have my pink sheet?"
DMV man: "no, I need the ME form."
Me: "but I've paid for it. I can't use it without the ME form, which is fine, I won't be using it until I'm employed, but you can still give it to me. I can be in possession of it, it's like being in possession of expired insurance. it's useless, but not illegal to have."
DMV man: "no, I can't, not without the ME form."
Me: "then give me back my receipt of payment."
DMV man: "it's in with your paperwork, it's fine."
Me: "FINE." about to esplode, so time to leave. I do believe I may have accomplished flouncing without a skirt, difficult as that sounds.

3c.) Marit walks to Peet's and gets eggnog freddo blended coffee thing. mmm. blendynog. calls doc. explains fun with DMV HELL and gets OK to come fix form.

3d.) Marit walks into office. Explains, points out places needing fixing. receptionist gives me the eyebrow-raised "really?" face. I nod. yes, really. she stamps office stamp on form. doc who saw me has gone home, but other PA gives me "really?" face (yes, really.) and writes in 20/200 twice on form, and writes out DL number. fun dialogue: "oh, can I see your driver's lic-oh, wait, it's written right here. *pause, gives me 'really?' face.* they made you come back for this?" (yes, really.) Marit pops into Whole Foods for orchard smoothy of goodness before slipping onto bus.

3e.) Marit is really regretting wearing shoes of the 'I need mood-booster of cuteness' type instead of 'I can walk all day and not care' type. target flats = cute yes, supportive no.

3f.) Marit gets back to DMV. is maybe 30 min to closing. DMV man non vis, so has to get new number. waits. waits. walks to desk when called. "here's my medical form! give me ADL please!" plasters content face on....the end is in sight! yay!

orange highlighter comes out. oh, fuck no, sister. noooononono. no way. no. bloody. way.

the red box for heart rate has two boxes to be checked; one says 'regular' and the other 'irregular' and underneath 'irregular' is the word 'rate.' the doc (and I) took this to mean 'if you check 'regular,' no numerical rate is required.'
But no. it is A RED BOX. red boxes must be filled out OR THE WORLD WILL END IN FLAMES. I shake my head as she is highlighting.
Me: "No, no. The doctor said that if the rate was regular, the numerical rate was not required. that's how your red box is structured. That box is filled out."
DMV Woman: "the red boxes has to be filled out."
Me: "...it is!"
DMV Woman: "all red boxes-" (I interrupt.)
Me: "The doctor told me that the box was filled out as is."
DMV Woman fetches supervisor.
DMV Supervisor: "hello, ma'am, I've spoken to-"
Me: "Fine. Give it back." I will not cry in the DMV. I will not cry in the DMV. I might scream in the DMV, but that might make the rent-a-cops do something they might regret. I will not scream OR cry in the DMV.
walk my way back to BART. have fallen off end of rope. nice (but very blurry- am walking without glasses. hah you bastards I promised not to walk without corrective lenses AND I DID. and totally didn't walk into any trees, either. branches...well...) lady asks me if I'm ok. I mumble something about end of horrible day just want to get home to bathtub whimper.
fun fact: it's now after 1700 and Marit realizes the only sustenance she has taken in was a greek yogurt at 0830 and the blendynog and the orchard smoothy of goodness. the fateful decision to not stop at great little sandwich place in berserkeley is instantly regretted.

4a.) Marit revolts and does absolutely nothing related to DMV or job search or anything other than go from bathtub to curled up in bed to bathtub to curled up on couch mainlining Advil for all of Friday. Screw you, Uterus. Awesome timing.

5a). calls doctor on saturday. "hi, it's me, the DMV form girl, I have another box that needs to be filled in."
"really?"
"yes. apparently despite the formatting of their box they need a heart rate for a normal rhythm anyway."
"um."
"yes?"
"you're doing this for your ambulance driver's certificate, right? and you're an EMT?'
"yes."
"and they want you to come in and have a doctor take your pulse and write it in their box."
"yep."
"...but you're an EMT."
"I know."
"um...you can't take your own pulse? I mean...the PA's already signed it...not that you should cheat on a form, I don't mean...but...you're an EMT."
"I know. Believe me, I know. if it weren't for the certainty that if I did just take my own pulse and write it in, they would somehow know and I'd have to start over or get audited or whatever medieval torture they have planned for offences like that, I would just fill it in myself. When can I stop by?"
"Monday?"
"See you Monday."

5b.) walk in to doctor's office. Doc: "so, what's your pulse?" Me: "84." Doc: "really? *checks* huh." Me: "I know. my BP's on the low end, HR on the high end. Always has been." Doc: "no coffee?" Me: "Not yet." Doc: "huh. Well, good luck."

5c.) walk in to DMV. get number. wait. wait. (learning has occured. Marit brought a book instead of prayer stole.) wait. wait. goes up to desk when summoned. Hands over ME form. DMV woman 2 disappears. Now, I had to do a good deal of waiting at the desk with the first edition of DMV (see 2c), but she always said something along the lines of 'I'm going to go ::insert task here::' or 'I just need to check with ____, I haven't done one of these yet' before disappearing, and told me that I could take a seat if I was more comfortable that way. (there's a reason why she is DMV Lady in my head and the others are DMV woman.) DMV woman just disappears. she wanders from the left side of the building to the right side of the building, disappears into the back, reappears, wanders circuit again...four people rotate through the desk next to hers. finally, after at least 30 min of being gone, when Teh Bitchy Marmot is about to make an appearance, she reappears and hands over the little pink slip.

6.) Marit makes good her escape, then makes wallet cry by stuffing pink slip in wallet. goes for blendynog. mmm. blendynog.

Thus endeth the saga.

Next: the Jobhunting Strikes Back.