ow. I has hurt. (like ich habe hunger-unger-unger-unger, only more painful and less melodic.)
why has I hurt? Well, Le Marmot went for a run yesterday. (a jog. Le Marmot does not likey the runny. Why does Le Marmot not likey the runny? take the contents of a 16 or so ounce can and put them in a plastic baggie. repeat with another can's contents. now put on a bra and insert baggies. now go run.) Le Marmot also doesn't likey the runny because she's not in the best of shape, if we're being honest. but mostly: boobs. ow. if someone has Teh Miracle Bra please tell me because my sports bra just gives me one floppy uniboob.
Then, Le Marmot did some yoga/strength training on the Wiifit.
that was yesterday.
Today, I got to spend an entire call holding an IV bag over my head, because our gurneys don't have IV poles (because they all got stolen from our station and sent into the city) and because for some reason they didn't mount a hook on our rig. (Like they didn't mount an EMT-catcher, which is my favorite thing evar. not. especially when we're on the freeway. hit the brakes too fast or swerve and I'm eating cabinets. with my face. woo. hoo.)
and then we had a stair chair call. (hey, you guys wanna run one more call? pretty please? it's a discharge and it's only 3 miles away? sure, we'll run it. ok great! um...there's stairs, do you have a stair chair? ....grmblersgrnfrazzer yes.)
now I feel like Kronk in Emperor's New Groove: "back elbows shoulders *thud*"
Also, question: how in the hell do you interpret this:
For the holy spirit and we ourselves have favored adding no further burden to YOU, except these necessary things, to keep abstaining from things sacrificed to idols and from blood and from things strangled and from fornication. If YOU carefully keep yourselves from these things, YOU will prosper. Good health to YOU!” (acts 15:28-29)
which is the same as this:
For it seemed good to the Holy Ghost, and to us, to lay upon you no greater burden than these necessary things; That ye abstain from meats offered to idols, and from blood, and from things strangled, and from fornication: from which if ye keep yourselves, ye shall do well. Fare ye well.
to mean blood transfusions = evil?
and also...why is YOU capitalized everywhere, but yourselves isn't? shouldn't it be if YOU carefully keep YOURSELVES? ...skippy. box. now.
Thursday, April 30, 2009
Sunday, April 26, 2009
Haven't done this in awhile.
| Your Life: The Soundtrack Created by aiko and taken 167054 times on Bzoink | |
| Opening credits: | Star Wars Theme (techno remix) |
| Waking up: | She Blinded Me With Science! (Thomas Dolby) |
| Average day: | Vi Krangler (De Lillos) |
| First date: | Sigur Ros (Sigur Ros) |
| Falling in love: | Prime Audio Soup (Meat Beat Manifesto) |
| Love scene: | Contact (Rent Original Broadway Cast) |
| Fight scene: | Bach's Fantasie in C Maj BWV 570 (Empire Brass and Bill Kuhlman Baroque Music for Brass and Organ) |
| Breaking up: | One Headlight (The Wallflowers) |
| Getting back together: | Hår Som Spunnid Gull (Lumsk) |
| Secret love: | Hver Gang Jeg Går Rund Her (Postgirobygget) |
| Life's okay: | Dirty Dancing (Black Eyed Peas) |
| Mental breakdown: | Bak Et Halleluja (Kaizers Orchestra) |
| Driving: | Tamacun (Rodrigo y Gabriela) |
| Learning a lesson: | The Happiest Days of Our Lives (Pink Floyd) |
| Deep thought: | Gia Sena (Elli Kokkinou) |
| Flashback: | The Climb (No Doubt) |
| Partying: | Juta (Georgia State Dance Company Orchestra) |
| Happy dance: | Eye Patch (Robert Rodriguez/Once Upon A Time In Mexico) |
| Regreting: | Marillion (Paul Oakenfold) |
| Long night alone: | Don't Speak (No Doubt) |
| Death scene: | Gjendines Bånsull |
| Closing credits: | Cambodia -Fragma Remix (Pulsedriver) |
| You've been totally Bzoink*d! Take This Survey | Search Surveys | Create a Survey | |
Waking up is quite likely. My fight scene...seems a little strange. I think Breaking Up and Getting Back Together are backwards.
Friday, April 24, 2009
Got out of town on a boat for the southern islands...
I stole this from Pixiethief, who stole it from someone else in turn.
01. Make a list of 5 things you can see:
1.) Kittens attempting to kill each other
2.) the project bin that's achieved sentience (or at least sexual maturation. it's breeding. trust me. that half-spun green fleece was not there yesterday.)
3.) My poor lily-of-the-valley plant that needs water.
4.) the nerdiest guitar hero guitar ever.
5.) The wiifit, which is frowning in disapproval at me.
02. WHAT'S THE FIRST SCAR YOU EVER GOT?
The bump on my lip and eyebrow slice from faceplanting onto an ice slide in 4th grade is the earliest thing I remember. (They match nicely with the scar from sticking a braces bracket through my lip faceplanting off a 60-in play ball, which lines up perfectly with the scar from faceplanting into a slate-bottomed stream (sensing a theme? hey, at least I saved the camera!*) and makes it sort of look like I was in a knife fight.) I'm sure I have something from earlier. Mom?
03. Is there anything in your fridge right now that you would never eat/drink?
Matt's French's mustard. *shudder*
04. What's your occupation?
Sir/Ma'am-I'm-an-EMT-can-I-help-you?
05. Do you nap a lot?
Not really. I tend to need more than 3 hours or less than 10 minutes. I do a lot of middle-distance staring, though, which might count.
06. What was your first celebrity crush?
Adrian Paul. or Johnny Depp. But most likely Adrian Paul.
07. What's your current fandom/obsession/addiction?
Firefly, making sure the eel is still alive, iced espresso con panna from the little italian cafe, the next Dresden book.
08. What are you listening to right now?
Bill Maher.
09. What was the last text message you received?
Something from Mom, I think.
10. What websites do you always visit when you go online?
Gmail, Ravelry, several webcomics.
11. What was the last thing you bought?
Saline.
12. Cutest thing you have seen today?
Raz pleading for my ice cream.
13. Does the weather affect your mood?
not usually. unless it's snowing. then I get ridiculously happy. Snow!
14. What is your zodiac sign?
Gemini
15. Pets?
Jayne, the box dropping man ape gone wrong kitty, and Raziel, the crazy psycho jungle kitty that I wanted to name Mister since he's huge and grey, but The Boy wasn't interested. two bettas, a goldfish named Aurelius, an african dwarf frog named La Grenouille, an eel named Amore, and a smattering of white cloud minnows, blue danios, and longfin cherry barbs.
16. A saying you live by/that you have remembered and has inspired you?
From Mr Nyline (my band director at Luther, said after every band rehearsal.):
Stay out of work, stay out of trouble, stay out of jail. (sometimes he ended with "Stay hungry.")
17. What is the story behind your username?
I think it was james or xander who first started calling me marmot, which is one of the few nicknames that stuck, and I knit, so...marmotknit. (my old lj was picklechild, which has a long and mostly-inappropriate backstory involving the renaissance festival and the pickle sellers.)
18. What's something you'd like to say to someone right now?
I caaaaan't take any more songs with the word 'shawtie' in it. OMGMAKEITSTOP.
19. What are your plans for next weekend?
not sure yet. The Boy has to work, so probably nothing exciting.
20. Say something to the person who tagged you:
rather existential since no one tagged me.
*so I'm towards the rear of my classmates, and we're sprawled over a wide swath of vidda hiking back to civilization, and I'm fording a stream. For the record, slate + a few inches of really cold water = slippery rocks that slide around amongst themselves. I slip. My camera is around my neck and one shoulder, standard carry position, and as I'm falling I take it in one hand to keep it out of the water or from being smashed between me and the rocks. This leaves me with one hand to stop me and my giant-ass purple pack from going splat. I retain the presence of mind to not stop myself with an outstretched hand, and smack the ground. Ow. Get up, inspect camera- a little bend on the filter edge, but that's ok. why does my lip hurt? *prod* oh, look, lots of blood. I look up and Levi is standing next to me, observing the events of the past few seconds. he hands me a cloth of some ilk, then steps back and shakes his head slightly, saying only "...Foto." (the shorthand for our photography class.) Four stitches (sans novocaine! OW bloody OW!) and I'm impersonating angelina jolie for a week.
01. Make a list of 5 things you can see:
1.) Kittens attempting to kill each other
2.) the project bin that's achieved sentience (or at least sexual maturation. it's breeding. trust me. that half-spun green fleece was not there yesterday.)
3.) My poor lily-of-the-valley plant that needs water.
4.) the nerdiest guitar hero guitar ever.
5.) The wiifit, which is frowning in disapproval at me.
02. WHAT'S THE FIRST SCAR YOU EVER GOT?
The bump on my lip and eyebrow slice from faceplanting onto an ice slide in 4th grade is the earliest thing I remember. (They match nicely with the scar from sticking a braces bracket through my lip faceplanting off a 60-in play ball, which lines up perfectly with the scar from faceplanting into a slate-bottomed stream (sensing a theme? hey, at least I saved the camera!*) and makes it sort of look like I was in a knife fight.) I'm sure I have something from earlier. Mom?
03. Is there anything in your fridge right now that you would never eat/drink?
Matt's French's mustard. *shudder*
04. What's your occupation?
Sir/Ma'am-I'm-an-EMT-can-I-help-you?
05. Do you nap a lot?
Not really. I tend to need more than 3 hours or less than 10 minutes. I do a lot of middle-distance staring, though, which might count.
06. What was your first celebrity crush?
Adrian Paul. or Johnny Depp. But most likely Adrian Paul.
07. What's your current fandom/obsession/addiction?
Firefly, making sure the eel is still alive, iced espresso con panna from the little italian cafe, the next Dresden book.
08. What are you listening to right now?
Bill Maher.
09. What was the last text message you received?
Something from Mom, I think.
10. What websites do you always visit when you go online?
Gmail, Ravelry, several webcomics.
11. What was the last thing you bought?
Saline.
12. Cutest thing you have seen today?
Raz pleading for my ice cream.
13. Does the weather affect your mood?
not usually. unless it's snowing. then I get ridiculously happy. Snow!
14. What is your zodiac sign?
Gemini
15. Pets?
Jayne, the box dropping man ape gone wrong kitty, and Raziel, the crazy psycho jungle kitty that I wanted to name Mister since he's huge and grey, but The Boy wasn't interested. two bettas, a goldfish named Aurelius, an african dwarf frog named La Grenouille, an eel named Amore, and a smattering of white cloud minnows, blue danios, and longfin cherry barbs.
16. A saying you live by/that you have remembered and has inspired you?
From Mr Nyline (my band director at Luther, said after every band rehearsal.):
Stay out of work, stay out of trouble, stay out of jail. (sometimes he ended with "Stay hungry.")
17. What is the story behind your username?
I think it was james or xander who first started calling me marmot, which is one of the few nicknames that stuck, and I knit, so...marmotknit. (my old lj was picklechild, which has a long and mostly-inappropriate backstory involving the renaissance festival and the pickle sellers.)
18. What's something you'd like to say to someone right now?
I caaaaan't take any more songs with the word 'shawtie' in it. OMGMAKEITSTOP.
19. What are your plans for next weekend?
not sure yet. The Boy has to work, so probably nothing exciting.
20. Say something to the person who tagged you:
rather existential since no one tagged me.
*so I'm towards the rear of my classmates, and we're sprawled over a wide swath of vidda hiking back to civilization, and I'm fording a stream. For the record, slate + a few inches of really cold water = slippery rocks that slide around amongst themselves. I slip. My camera is around my neck and one shoulder, standard carry position, and as I'm falling I take it in one hand to keep it out of the water or from being smashed between me and the rocks. This leaves me with one hand to stop me and my giant-ass purple pack from going splat. I retain the presence of mind to not stop myself with an outstretched hand, and smack the ground. Ow. Get up, inspect camera- a little bend on the filter edge, but that's ok. why does my lip hurt? *prod* oh, look, lots of blood. I look up and Levi is standing next to me, observing the events of the past few seconds. he hands me a cloth of some ilk, then steps back and shakes his head slightly, saying only "...Foto." (the shorthand for our photography class.) Four stitches (sans novocaine! OW bloody OW!) and I'm impersonating angelina jolie for a week.
because every so often...
...you just need some firefly.
I have a ranty but I'm too tired to be coherent or fair. so maybe tomorrow. For now, Firefly.
Mal: If anyone gets nosy, just, you know, shoot 'em.
Zoe: Shoot 'em?
Mal: Politely.
Mal: See, this is a sign of your tragic space dementia. All paranoid and crotchety, it breaks the heart.
Mal: "This isn't happening." (to Saffron) "Will you stop crying?"
Inara: "Oh, for God's sake, Mal, can you be a human being for thirty seconds?"
Wash: "Speaking as one married man to another..."
Mal: "I am not married!" (to Saffron) "I'm sorry. You don't shame me, you have very nice qualities but I didn't ever marry you."
Book: (holding encyclopedia) "I believe you did. Last night." (Mal hesitates, steps toward Jayne
Mal: (to Jayne, quiet) "How drunk was I last night?"
Jayne: "I dunno, I passed out."
Zoe: Sir, I think you have a problem with your brain being missing.
Wash: "Don't fall asleep now. Sleepiness is weakness of character. Ask anyone! You're acting captain. Know what happens you fall asleep now?"
Zoe: "Jayne slits my throat and takes over."
Wash: "That's right."
Zoe: "And we can't stop it."
Wash: "Well, I wash my hands of it. It's a hopeless case. I'll read a nice poem at the funeral. Something with imagery."
Zoe: "You could lock the door and keep the power-hungry maniac at bay."
Wash: "Oh, no, I'm starting to like this poetry idea now. 'Here lies my beloved Zoe, my autumn flower, somewhat less attractive now she's all corpsified and gross'..."
Zoe: Planet's coming up a might fast.
Wash: Just means I'm going down too quick. Likely crash and kill us all.
Mal: That happens, let me know.
Mal: Define 'interesting.'
Wash: "Oh God, Oh God, we're all gonna die?"
Wash: You want a slinky dress? I can buy you a slinky dress. Captain, can I have money for a slinky dress?
Jayne: I'll chip in.
Zoe: I can hurt you.
Kaylee: These girls have the most beautiful dresses. And so do I, how 'bout that!
Mal: Well, careful with it. We cheated Badger outta good money to buy that frippery. You're supposed to make me look respectable.
Kaylee: Yes sir, Captain Tightpants.
Jayne: We need a di-version. I say Zoe gets nekkid.
Wash: Nope.
Jayne: I could get nekkid.
Simon/Zoe/Wash: No!
Badger: "Why ain't she talking? She's got a secret."
River: "Sure, I got a secret. More'n one. Don't seem likely I'd tell them t'you, now, do it? Anyone off Dyton Colony knows better'n t'talk t'strangers. You're talkin' loud enough for the both of us, though, en't'ya? I've known a dozen like you. Skipped off home early. Run graft jobs 'ere and there. Spent some time in the lockdown, but less'n you claim. Now you're what? Petty thief with illusions of standing? Sad little king of a sad little hill."
Badger: "...Nice to see someone from the old homestead."
River: "Not really." (to Simon) "Call me if anyone interesting shows up."
Badger: "I like her."
Jayne: "That right there? Exactly the kind of di-version we coulda used."
Mal: How can you say that? How can you shame me in front of new people?
Jayne: If I could make you prettier, I would.
Mal: You are not the man I met a year ago.
River: Noah's Ark is a problem.
Book: Really.
River: We'll have to call it early quantum state phenomenon. Only way to fit five thousand species of mammal on the same boat.
River: Also, I can kill you with my brain.
Mal: "And Kaylee, what the hell's goin' on in the engine room? Were there monkeys? Some terrifying space monkeys maybe got loose?"
Simon: My sister's a ship. We had a fairly complicated childhood.
Jayne: "Well, I say as a rule that girlfolk ain't to be trusted." River: "Jayne is a girl's name."
Mal: "I hate to bring up our imminent arrest during your crazy time, but we gotta move."
Zoe: "River, honey? He's putting the hair away now." River: "It'll still be there... waiting...."
Jayne Cobb: I once hit a guy in the neck from 500 yards with a bent scope. Don't that count upstairs?
Book: Oh, it'll be taken into consideration.
Jayne Cobb: You made that sound kinda ominous.
Jayne: "Anyone remember her coming at me with a butcher knife?"
Wash: "Wacky fun..."
Jayne: "You want to go, little man?"
Wash: "Only if it's someplace with candlelight."
Zoe: "Sir, I know she's unpredictable, but I don't think she'd harm anyone.
Jayne: "Butcher's knife?!"
Zoe: "Anyone we can't spare."
Inara: "Every well-bred petty crook knows -- the small concealable weapons always go to the far left of the place setting."
Mal: Try to see past what she is, on to what she can be.
Zoë: What's that, sir?
Mal: Freedom, is what.
Zoë: [pointing] No, I meant — what's that?
Mal: Oh. Just step around it. I think something must've been living in here.
Zoë: Get her running again?
Mal: Yeah.
Zoë: So...not running now?
Mal: Not so much.
Jayne: "You know what the chain of command is? It's the chain I go get and beat you with until you understand who's in ruttin' command here. (beat) You can't change that... by gettin' all... bendy."
Wash: "All what?"
Jayne: "You got the... the light... from the console... keep you... lift you up. They shine like... (snatching at the air)... little... angels..." (falls over, unconscious) Wash: "Did he just go crazy and fall asleep?
Mal: "But she was naked! And... ...articulate!"
Sigh. Best. Show. Ever.
I have a ranty but I'm too tired to be coherent or fair. so maybe tomorrow. For now, Firefly.
Mal: If anyone gets nosy, just, you know, shoot 'em.
Zoe: Shoot 'em?
Mal: Politely.
Mal: See, this is a sign of your tragic space dementia. All paranoid and crotchety, it breaks the heart.
Mal: "This isn't happening." (to Saffron) "Will you stop crying?"
Inara: "Oh, for God's sake, Mal, can you be a human being for thirty seconds?"
Wash: "Speaking as one married man to another..."
Mal: "I am not married!" (to Saffron) "I'm sorry. You don't shame me, you have very nice qualities but I didn't ever marry you."
Book: (holding encyclopedia) "I believe you did. Last night." (Mal hesitates, steps toward Jayne
Mal: (to Jayne, quiet) "How drunk was I last night?"
Jayne: "I dunno, I passed out."
Zoe: Sir, I think you have a problem with your brain being missing.
Wash: "Don't fall asleep now. Sleepiness is weakness of character. Ask anyone! You're acting captain. Know what happens you fall asleep now?"
Zoe: "Jayne slits my throat and takes over."
Wash: "That's right."
Zoe: "And we can't stop it."
Wash: "Well, I wash my hands of it. It's a hopeless case. I'll read a nice poem at the funeral. Something with imagery."
Zoe: "You could lock the door and keep the power-hungry maniac at bay."
Wash: "Oh, no, I'm starting to like this poetry idea now. 'Here lies my beloved Zoe, my autumn flower, somewhat less attractive now she's all corpsified and gross'..."
Zoe: Planet's coming up a might fast.
Wash: Just means I'm going down too quick. Likely crash and kill us all.
Mal: That happens, let me know.
Mal: Define 'interesting.'
Wash: "Oh God, Oh God, we're all gonna die?"
Wash: You want a slinky dress? I can buy you a slinky dress. Captain, can I have money for a slinky dress?
Jayne: I'll chip in.
Zoe: I can hurt you.
Kaylee: These girls have the most beautiful dresses. And so do I, how 'bout that!
Mal: Well, careful with it. We cheated Badger outta good money to buy that frippery. You're supposed to make me look respectable.
Kaylee: Yes sir, Captain Tightpants.
Jayne: We need a di-version. I say Zoe gets nekkid.
Wash: Nope.
Jayne: I could get nekkid.
Simon/Zoe/Wash: No!
Badger: "Why ain't she talking? She's got a secret."
River: "Sure, I got a secret. More'n one. Don't seem likely I'd tell them t'you, now, do it? Anyone off Dyton Colony knows better'n t'talk t'strangers. You're talkin' loud enough for the both of us, though, en't'ya? I've known a dozen like you. Skipped off home early. Run graft jobs 'ere and there. Spent some time in the lockdown, but less'n you claim. Now you're what? Petty thief with illusions of standing? Sad little king of a sad little hill."
Badger: "...Nice to see someone from the old homestead."
River: "Not really." (to Simon) "Call me if anyone interesting shows up."
Badger: "I like her."
Jayne: "That right there? Exactly the kind of di-version we coulda used."
Mal: How can you say that? How can you shame me in front of new people?
Jayne: If I could make you prettier, I would.
Mal: You are not the man I met a year ago.
River: Noah's Ark is a problem.
Book: Really.
River: We'll have to call it early quantum state phenomenon. Only way to fit five thousand species of mammal on the same boat.
River: Also, I can kill you with my brain.
Mal: "And Kaylee, what the hell's goin' on in the engine room? Were there monkeys? Some terrifying space monkeys maybe got loose?"
Simon: My sister's a ship. We had a fairly complicated childhood.
Jayne: "Well, I say as a rule that girlfolk ain't to be trusted." River: "Jayne is a girl's name."
Mal: "I hate to bring up our imminent arrest during your crazy time, but we gotta move."
Zoe: "River, honey? He's putting the hair away now." River: "It'll still be there... waiting...."
Jayne Cobb: I once hit a guy in the neck from 500 yards with a bent scope. Don't that count upstairs?
Book: Oh, it'll be taken into consideration.
Jayne Cobb: You made that sound kinda ominous.
Jayne: "Anyone remember her coming at me with a butcher knife?"
Wash: "Wacky fun..."
Jayne: "You want to go, little man?"
Wash: "Only if it's someplace with candlelight."
Zoe: "Sir, I know she's unpredictable, but I don't think she'd harm anyone.
Jayne: "Butcher's knife?!"
Zoe: "Anyone we can't spare."
Inara: "Every well-bred petty crook knows -- the small concealable weapons always go to the far left of the place setting."
Mal: Try to see past what she is, on to what she can be.
Zoë: What's that, sir?
Mal: Freedom, is what.
Zoë: [pointing] No, I meant — what's that?
Mal: Oh. Just step around it. I think something must've been living in here.
Zoë: Get her running again?
Mal: Yeah.
Zoë: So...not running now?
Mal: Not so much.
Jayne: "You know what the chain of command is? It's the chain I go get and beat you with until you understand who's in ruttin' command here. (beat) You can't change that... by gettin' all... bendy."
Wash: "All what?"
Jayne: "You got the... the light... from the console... keep you... lift you up. They shine like... (snatching at the air)... little... angels..." (falls over, unconscious) Wash: "Did he just go crazy and fall asleep?
Mal: "But she was naked! And... ...articulate!"
Sigh. Best. Show. Ever.
Tuesday, April 14, 2009
With Apologies to Pliny the Elder.
Just shy of 50,000 dollars for a year at the Monterey Institute. I'd need 2.
well, fuck.
on the up side, even though Teh Intarwebs says you could have all manner of nasty, permanent, possibly-fatal diseases, it's vanishingly unlikely that you actually do, and the doctor will tell you that. Which is what I was expecting. Still. do I get points for creeping out the doctor? ("If that's what you expected...why did you come in?" "because murphy moves in mysterious ways." "...I'm sorry?" "murphy. Murphy's Law. Anything that can go wrong, will? or O'Toole's commentary on Murphy's Law? Murphy was an optimist?" "oh..kay?" "nevermind.") (she really should have been suspicious when I wrote on my drug history "ibuprofen/acetaminophen prn cramps/headache." the nursing assistant pointed to prn and asked me what that word was (yes I have scribbly writing SHUTUPdie). I said "prn. pro re nata. for the thing (which has been) born, or appeared...or less literally for the reason that appeared, or....(as I take in look of 'ohdeargod she's crazy')...um...per patient request." Yes, I said pretty much all that. it is NOT my fault, it was 0725 and I had NOT been allowed coffee AND I'd been awake since 0545.
I blame genetics. I'm betting bits of my DNA don't actually say GACTGACTATGCGCTATAATGC but ΓΑΧΤΓΑΧΤΑΤΓΧΓΧΤΑΤΑΑΤΓΧ.
well, fuck.
on the up side, even though Teh Intarwebs says you could have all manner of nasty, permanent, possibly-fatal diseases, it's vanishingly unlikely that you actually do, and the doctor will tell you that. Which is what I was expecting. Still. do I get points for creeping out the doctor? ("If that's what you expected...why did you come in?" "because murphy moves in mysterious ways." "...I'm sorry?" "murphy. Murphy's Law. Anything that can go wrong, will? or O'Toole's commentary on Murphy's Law? Murphy was an optimist?" "oh..kay?" "nevermind.") (she really should have been suspicious when I wrote on my drug history "ibuprofen/acetaminophen prn cramps/headache." the nursing assistant pointed to prn and asked me what that word was (yes I have scribbly writing SHUTUPdie). I said "prn. pro re nata. for the thing (which has been) born, or appeared...or less literally for the reason that appeared, or....(as I take in look of 'ohdeargod she's crazy')...um...per patient request." Yes, I said pretty much all that. it is NOT my fault, it was 0725 and I had NOT been allowed coffee AND I'd been awake since 0545.
I blame genetics. I'm betting bits of my DNA don't actually say GACTGACTATGCGCTATAATGC but ΓΑΧΤΓΑΧΤΑΤΓΧΓΧΤΑΤΑΑΤΓΧ.
Thursday, April 09, 2009
So Depressing.
These requirements are for a job that pays 3 to 6 dollars more than my current job.
Requirements: H.S. diploma. Familiarity with data entry, high attention to detail and accuracy, flexibility, and good communication skills are needed. Ability to follow laboratory protocols and access to a car are required. Previous experience in specimen handling is desirable.
whatdefmrgl. seriously.
Requirements: H.S. diploma. Familiarity with data entry, high attention to detail and accuracy, flexibility, and good communication skills are needed. Ability to follow laboratory protocols and access to a car are required. Previous experience in specimen handling is desirable.
whatdefmrgl. seriously.
Friday, April 03, 2009
three....darts....is....too...many....
caffeine, don't fail me now, baby.
Pumpkin Pie the First: done.
Pumpkin Pielet the Second: done. a bit too done. oh well. it's not really a pielet. it's just a little less...dense. yeah. that's it.
Margarita Pie the First: ...shush.
Margarita Pie the Second: ...uh...dependent on marit finding another can of sweetened condensed milk somewhere. this is not as big of a stretch as you might think.
what time is it? oh yeah....crap.
Am also supposed to finish up my last moleskine and go, but I need to sit down, stare at it, and repeat to myself "Marit. Perfectionism is BAD. It's fine. It's done. Remember Mrs Hess? Forcibly taking away your self portrait? Mrs Hess is, right now, at this very moment, twitching, and she doesn't know why. Put. The Sketchbook. Down." until I can shove it in an envelope.
what did we learn today, kids? Don't mention Iowa being more awesome than California to a Witness. (I mean...it's Iowa. ...not Luther, but Iowa. I-ow-a.)
Also, How To Make Someone's Eyes Go Boogley and Score One For Classical Dance: find a video on youtube of a professional male ballet dancer warming up with a rig on that shows muscle strain and forces. watch fellow EMT eyes go boogley and hear lots of "WTF is that?" "that's a quad." "that can't be a quad muscle. that's fucking huge." Yes, boys, tiny sissy little dancer-man can break you. in half. without breaking a sweat.
funfact? Adrian Paul is exactly 24 years older than I am. Yes, you're going to have to put up with more geekiness. this is what comes of being all post-migrane-fucked-up and watching a whole day of Highlander. I'm singing Queen to myself and making my partner look at me funny as I do parry drills waiting in hallways.
Pumpkin Pie the First: done.
Pumpkin Pielet the Second: done. a bit too done. oh well. it's not really a pielet. it's just a little less...dense. yeah. that's it.
Margarita Pie the First: ...shush.
Margarita Pie the Second: ...uh...dependent on marit finding another can of sweetened condensed milk somewhere. this is not as big of a stretch as you might think.
what time is it? oh yeah....crap.
Am also supposed to finish up my last moleskine and go, but I need to sit down, stare at it, and repeat to myself "Marit. Perfectionism is BAD. It's fine. It's done. Remember Mrs Hess? Forcibly taking away your self portrait? Mrs Hess is, right now, at this very moment, twitching, and she doesn't know why. Put. The Sketchbook. Down." until I can shove it in an envelope.
what did we learn today, kids? Don't mention Iowa being more awesome than California to a Witness. (I mean...it's Iowa. ...not Luther, but Iowa. I-ow-a.)
Also, How To Make Someone's Eyes Go Boogley and Score One For Classical Dance: find a video on youtube of a professional male ballet dancer warming up with a rig on that shows muscle strain and forces. watch fellow EMT eyes go boogley and hear lots of "WTF is that?" "that's a quad." "that can't be a quad muscle. that's fucking huge." Yes, boys, tiny sissy little dancer-man can break you. in half. without breaking a sweat.
funfact? Adrian Paul is exactly 24 years older than I am. Yes, you're going to have to put up with more geekiness. this is what comes of being all post-migrane-fucked-up and watching a whole day of Highlander. I'm singing Queen to myself and making my partner look at me funny as I do parry drills waiting in hallways.
Thursday, April 02, 2009
there is a plus side to recovering from Migrane Madness.
Scifi has been running a marathon of Marmot's favorite guilty pleasure.
what? if I'm going to be scrubbing bloodstains out, it might as well be to the tune of the sexiest theme song by the most awesome band ever with the so-jumpworthy* Adrian Paul.
yes I realize that that sends my geekness quotient into the stratosphere, and I don't care. one of my partners was playing with my phone, and one of the random songs I managed to get loaded is that theme song, and it played. He looked at me and said "HAH you totally just had a guilty little look on your face!" and I went "well...it's....Queen." and there was a long pause. "And I am somewhat of a sucker for guys with long hair and swords, so sue me." and he said "yeah, I saw that coming." I don't know why.
*total high school flashback. whoa. Hi Kirsten! oh man. his bassness. such young foolishness.
what? if I'm going to be scrubbing bloodstains out, it might as well be to the tune of the sexiest theme song by the most awesome band ever with the so-jumpworthy* Adrian Paul.
yes I realize that that sends my geekness quotient into the stratosphere, and I don't care. one of my partners was playing with my phone, and one of the random songs I managed to get loaded is that theme song, and it played. He looked at me and said "HAH you totally just had a guilty little look on your face!" and I went "well...it's....Queen." and there was a long pause. "And I am somewhat of a sucker for guys with long hair and swords, so sue me." and he said "yeah, I saw that coming." I don't know why.
*total high school flashback. whoa. Hi Kirsten! oh man. his bassness. such young foolishness.
Subscribe to:
Posts (Atom)
