With Apologies to Pliny the Elder.

Just shy of 50,000 dollars for a year at the Monterey Institute. I'd need 2.


well, fuck.

on the up side, even though Teh Intarwebs says you could have all manner of nasty, permanent, possibly-fatal diseases, it's vanishingly unlikely that you actually do, and the doctor will tell you that. Which is what I was expecting. Still. do I get points for creeping out the doctor? ("If that's what you expected...why did you come in?" "because murphy moves in mysterious ways." "...I'm sorry?" "murphy. Murphy's Law. Anything that can go wrong, will? or O'Toole's commentary on Murphy's Law? Murphy was an optimist?" "oh..kay?" "nevermind.") (she really should have been suspicious when I wrote on my drug history "ibuprofen/acetaminophen prn cramps/headache." the nursing assistant pointed to prn and asked me what that word was (yes I have scribbly writing SHUTUPdie). I said "prn. pro re nata. for the thing (which has been) born, or appeared...or less literally for the reason that appeared, or....(as I take in look of 'ohdeargod she's crazy')...um...per patient request." Yes, I said pretty much all that. it is NOT my fault, it was 0725 and I had NOT been allowed coffee AND I'd been awake since 0545.

I blame genetics. I'm betting bits of my DNA don't actually say GACTGACTATGCGCTATAATGC but ΓΑΧΤΓΑΧΤΑΤΓΧΓΧΤΑΤΑΑΤΓΧ.