Some of the things I see on etsy make me go "ooooo...." and some of the things on etsy make my fingers itch and me go "whaaaaa? you're selling that for $30 bucks? have you SEEN that join? hello? THAT IS NOT FINISHED. go back and buff the shit out of that sucker, then we'll talk about selling that for $30 bucks."
I want my perfect world, where I get to spend my sommers at Skogfjorden, I get to teach college kids about science on a sailing research vessel every so often, I get to use my free time for knitting and designing knitting and I can set up a little loom and I can weave and I can coerce James into helping me build a little baby kiln and a little baby forgelet and I can set up my lovely cancer-causing mesothelioma-inducing studio and make jewellery and sculpt and make knives all day when I'm not working. And I want to have juuust enough money left over that every couple years or so I get to travel someplace awesome that I haven't been (Antarctica, Africa, ...must...beat (at the very least tie)...alex....), or someplace awesome that I have been to. (Alta, Santorini, and at this particular moment, Nuku Hiva), or maybe just a week of heli-skiing. and I want to go ski touring. I want to pack my bag and find a sledge or train up a pair of dogs and get my tent and some matpakker and my reinsdyrskinn and GTFO and not come back until håret e så fett det fryser!
I want it all.
I want it all.
And I want it now. *screeeeeeelm*
Friday, December 11, 2009
Tuesday, December 08, 2009
Friday, December 04, 2009
My life according to Queen.
Using only song names from ONE ARTIST, cleverly answer these questions. Pass it on to people you like and include me. You can't use the artist I used. (sure you can.) Try not to repeat a song title. It's a lot harder than you think! Repost as "My Life According to (ARTIST NAME)"
Pick Your Artist: Queen
Are you a male or female? Killer Queen
Describe yourself: I'm Going Slightly Mad
How do you feel: I Want It All
Describe where you currently live: Seven Seas of Rhye
If you could go anywhere, where would you go: Bohemian Rhapsody
Your best friend is: Good Old Fashioned Lover Boy
Your favorite color is: Flash
What's the weather like? Who Wants To Live Forever
Favorite time of day: Surf's Up...School's Out!
If your life were a TV show, what would it be called: Princes of the Universe
What is life to you: Bicycle Race
Your current relationship: Innuendo
Your fear: Death on Two Legs
What is the best advice you have to give: Somebody to Love
If you could change your name, you would change it to: Delilah
Thought for the Day: One Vision
How I would like to die: Fat Bottomed Girls
My soul's present condition: Radio Ga Ga
My motto: Let Me Live
Pick Your Artist: Queen
Are you a male or female? Killer Queen
Describe yourself: I'm Going Slightly Mad
How do you feel: I Want It All
Describe where you currently live: Seven Seas of Rhye
If you could go anywhere, where would you go: Bohemian Rhapsody
Your best friend is: Good Old Fashioned Lover Boy
Your favorite color is: Flash
What's the weather like? Who Wants To Live Forever
Favorite time of day: Surf's Up...School's Out!
If your life were a TV show, what would it be called: Princes of the Universe
What is life to you: Bicycle Race
Your current relationship: Innuendo
Your fear: Death on Two Legs
What is the best advice you have to give: Somebody to Love
If you could change your name, you would change it to: Delilah
Thought for the Day: One Vision
How I would like to die: Fat Bottomed Girls
My soul's present condition: Radio Ga Ga
My motto: Let Me Live
Thursday, December 03, 2009
Sunday, November 22, 2009
ohdeargod.
it's November 22nd.
Ohgod.
T-minus 8 days and counting. EIGHT. ZOMG.
I can get by without sleep, right? all hail 1,3,7-trimethylxanthine! HAIL!
and laundry? what's that? The Boy can subsist on hotpockets and eggs, he's a big boy. Cat feeder and water are automatic. now all I need is TPN and a caffeine drip and we're good to go!
right?
guys?
Ohgod.
T-minus 8 days and counting. EIGHT. ZOMG.
I can get by without sleep, right? all hail 1,3,7-trimethylxanthine! HAIL!
and laundry? what's that? The Boy can subsist on hotpockets and eggs, he's a big boy. Cat feeder and water are automatic. now all I need is TPN and a caffeine drip and we're good to go!
right?
guys?
Sunday, November 15, 2009
cinematic nerdity
I gotta say...Twister is a great movie. it's got action and comedy and great characters and pretty sweet special effects and best of all, it has people (acting) totally and completely passionate about their science. they geek out. I start watching and I get the goofy grin on my face. it's awesomely geektastic.
Thursday, November 12, 2009
Tuesday, November 10, 2009
nanna-ream-o
nano...sucking...brain..power...
also, why can't I write in my sleep?
and...one of the best episodes of the best shows ever.
although that clip does leave out one good bit, where daniel points out that they could be doing anything they wanted and they both freeze, then exit post haste.
teal'c with the thermometer in his mouth? never fails to make me crack my face in half with a grin.
ok. fold clothes. bed.
also, why can't I write in my sleep?
and...one of the best episodes of the best shows ever.
although that clip does leave out one good bit, where daniel points out that they could be doing anything they wanted and they both freeze, then exit post haste.
teal'c with the thermometer in his mouth? never fails to make me crack my face in half with a grin.
ok. fold clothes. bed.
uh-huh.
you know it's time for bed when this makes you burst out laughing.
thank you, and good night.
thank you, and good night.
Sunday, November 01, 2009
NaNoWriMo
*cue pertinent Rimsky-Korsakov song*
too much crap to do today for serious writing BUT my reboot begins.
too much crap to do today for serious writing BUT my reboot begins.
Tuesday, October 27, 2009
YES.
Dammit, now I have to start watching Castle.
"didn't you wear that, like, five years ago?" SNORT.
yaarrrrrrn.
so I'm trying to kick-start my yarn weight loss campaign again. not a diet per se...but if I want to start a new project, I have to finish something else. if I want to buy more yarn for a project, then a corresponding amount of yarn has to be either done or leave some other way. (the craft depot, gifted, osv.)
so far not much has happened. although that's mostly to blame the work schedule. but I need to finish:
northern lights scawl*, which at this stage is...yarn. and a pattern. sort of.
Giant Shawl Of Death, currently lurking reproachfully at me, since finishing it implies ripping out...pretty much the entire thing. yeah.
Mystery Afghan Thing, which right now is more like "mystery washcloth thing"
and others, but I'm all ufo-depressed now and anyway, it's time for NCIS.
*could be a scarf. could be a shawl. might end up being a cowl. who knows? also, sounds like 'scowl,' which is what I currently do when I think of it.
so far not much has happened. although that's mostly to blame the work schedule. but I need to finish:
northern lights scawl*, which at this stage is...yarn. and a pattern. sort of.
Giant Shawl Of Death, currently lurking reproachfully at me, since finishing it implies ripping out...pretty much the entire thing. yeah.
Mystery Afghan Thing, which right now is more like "mystery washcloth thing"
and others, but I'm all ufo-depressed now and anyway, it's time for NCIS.
*could be a scarf. could be a shawl. might end up being a cowl. who knows? also, sounds like 'scowl,' which is what I currently do when I think of it.
Thursday, October 15, 2009
SUCH a good movie.
Saving Grace. seeing that tv show (which is totally unrelated to the film) in the tv menu makes me go YA-oh. sad.
see?
one of the reasons I love this movie is that James is Grace. if James were a little welsh lady who started to grow pot to avoid bankruptcy. although when I watched it with him the scene where she cleans out her greenhouse gave him the twitchy fits. "but that's worth- that one's! but!"
"my name is tony, I am from scandinavia."
"...he doesn't talk much."
"mhm...does he have to?"
And the internet just ate the rest. bugger. oh well. here's one of the best bits:
I thought of this movie on the latest Crazy Day (which has been somewhat washed away from Drowning Marmot Day on tuesday, but involved an entire ER getting serious contact highs from a patient)
Sunday, October 11, 2009
Wednesday, September 30, 2009
theraflu-induced randomness.
1) Mixed Berry with green tea and menthol Theraflu is more awful than normal Theraflu. I know, I know, I didn't think it was possible either. but trust me. Homeland Security, I got your new interrogation method right here.
2) I hate it when you're sick, so you take a sick day* at work, and then you wake up and you feel way better at noon-ish, so you think yeah, hey, awesome, I'll be back at work tomorrow, and then at 1500 suddenly you're back to sinus migrane of DEATH and taking the fucking recycling down and checking the mail makes you collapse back on the couch in exhaustion, and then you have to call in to work again for another sick day and you can feel the "...is it swine flu?" that's unasked and to make matters worse...
...it's time for more Mixed Berry Theraflu.
3) being mostly-catatonic has, though, given me a great gift: I finally got around to watching Glee.
seriously, the hours I spent going "meh, not so interested" are hours that I regret. deeply. I was never in a glee club (did Wayzata even have one?) but musical theatre is something I was raised on. you know in shows when people randomly break out in song? it took me an embarassingly long time to realize that normal people's parents don't sing phrases from musical of various obscurity in most situations. if no one else watches this show, my parents have to. the only downside to this is that I can't watch it with The Boy without sending him running for the hills.
(also, I've received the inability to type correctly. sheesh. dextromethorphan HBr and phenylephrine HCl and acetaminophen aren't altering drugs (besides, you know, sleepy-time), but you wouldn't know it by my typing skills)
4) New Dexter spot: artful cinematography paired with what song? Under Pressure.
this is why I love that show.
5)
6) Things Mawit Saw At Folsom:
Rainbow Brite (so not kidding.)
Guy Wearing a Snake (...only a snake.)
Guy Wearing a Hijab (...only a hijab.)
some really bad corsetry
some really good corsetry
lots of leather (well, duh.)
lots of nudity (also, duh.)
several small children (so not duh. really? yes, I understand, america is a little overly puritanical (ok, a lot) in some regards but...bob ditter says no!)
but the best thing was the XKCD tshirt on the guy wearing an interesting pair of pants.
7) the designers of the Breeze litterbox deserve sainthood. no kidding. by all rights should be stinkier than the lidded boxes we had been using (since they're open to the air) and granted, when Raz (who nearly got renamed Gollum/Smeagol) decides to leave us a present it's biohazard-worthy, but he actually usually succeeds in burying it and then we scoop it out (cause we don't have to fight with a lid and just scoop and dump) and then hey presto no stinky. and the pee goes down into a chuk and you don't change that for a week and it magically doesn't stink. Best. Litterbox. Ever.
8) I love Neil Patrick Harris.
9) Tsunami Watches are pretty boring, actually, which makes me sad that more people are talking about tsunami watch in the east bay than actual tsunami-earthquake-utter-destruction in Samoa.
10) Jayne is currently stalking an invisible critter that had damn well better not be a moth, because...well, it just better not be one.
11) every time I watch NCIS:LA I think of Katy because it's Chris O'Donnell. and good show, but...what's with the Incredibles lady?
12) Braid is an awesome game. if you've got an Xbox, you should buy Braid. so worth it. although if you play it for too long your brain goes splerkutyblip.
2) I hate it when you're sick, so you take a sick day* at work, and then you wake up and you feel way better at noon-ish, so you think yeah, hey, awesome, I'll be back at work tomorrow, and then at 1500 suddenly you're back to sinus migrane of DEATH and taking the fucking recycling down and checking the mail makes you collapse back on the couch in exhaustion, and then you have to call in to work again for another sick day and you can feel the "...is it swine flu?" that's unasked and to make matters worse...
...it's time for more Mixed Berry Theraflu.
3) being mostly-catatonic has, though, given me a great gift: I finally got around to watching Glee.
seriously, the hours I spent going "meh, not so interested" are hours that I regret. deeply. I was never in a glee club (did Wayzata even have one?) but musical theatre is something I was raised on. you know in shows when people randomly break out in song? it took me an embarassingly long time to realize that normal people's parents don't sing phrases from musical of various obscurity in most situations. if no one else watches this show, my parents have to. the only downside to this is that I can't watch it with The Boy without sending him running for the hills.
(also, I've received the inability to type correctly. sheesh. dextromethorphan HBr and phenylephrine HCl and acetaminophen aren't altering drugs (besides, you know, sleepy-time), but you wouldn't know it by my typing skills)
4) New Dexter spot: artful cinematography paired with what song? Under Pressure.
this is why I love that show.
5)
6) Things Mawit Saw At Folsom:
Rainbow Brite (so not kidding.)
Guy Wearing a Snake (...only a snake.)
Guy Wearing a Hijab (...only a hijab.)
some really bad corsetry
some really good corsetry
lots of leather (well, duh.)
lots of nudity (also, duh.)
several small children (so not duh. really? yes, I understand, america is a little overly puritanical (ok, a lot) in some regards but...bob ditter says no!)
but the best thing was the XKCD tshirt on the guy wearing an interesting pair of pants.
7) the designers of the Breeze litterbox deserve sainthood. no kidding. by all rights should be stinkier than the lidded boxes we had been using (since they're open to the air) and granted, when Raz (who nearly got renamed Gollum/Smeagol) decides to leave us a present it's biohazard-worthy, but he actually usually succeeds in burying it and then we scoop it out (cause we don't have to fight with a lid and just scoop and dump) and then hey presto no stinky. and the pee goes down into a chuk and you don't change that for a week and it magically doesn't stink. Best. Litterbox. Ever.
8) I love Neil Patrick Harris.
9) Tsunami Watches are pretty boring, actually, which makes me sad that more people are talking about tsunami watch in the east bay than actual tsunami-earthquake-utter-destruction in Samoa.
10) Jayne is currently stalking an invisible critter that had damn well better not be a moth, because...well, it just better not be one.
11) every time I watch NCIS:LA I think of Katy because it's Chris O'Donnell. and good show, but...what's with the Incredibles lady?
12) Braid is an awesome game. if you've got an Xbox, you should buy Braid. so worth it. although if you play it for too long your brain goes splerkutyblip.
Wednesday, September 23, 2009
best fucking wednesday EVER.
and it totally started out in The Pit...of Despaaaaaair, too, which makes it all the better.
the marmot gets essentially no sleep. Gets to work. boo, work. mawit tired. marit messed up proportions on coffee manufacturing in the morning. mawit sad. mawit gets coffee. things looking up. two calls down...then three...four...five. We're on our way to our sixth call and we drive past the Fox Theatre.
What's on the sign? Sep 23 Rodrigo y Gabriela.
what. WHAT. WHAAAT. mawit thinks "Dammit! I missed them AGAIN! WAIT! 23!!! 23 is TODAY!" grab phone. text mom to beg for info on concert start/price/etc.
starts at 8pm. tickets still available, 35 bucks. HELL. YES. text The Boy: hey remember rod y gab, want to go tonight?"
The Boy gets tickets with four minutes remaining. HELL. YES.
then, enter Murphy. we're delayed at our seventh call. dispatch has given us an eighth call, too, with a 5:30 pickup. PICKUP. mawit flips the fuck out. partner shakes head at mawit. of course we're gonna get a late call. we always get late calls. no, dispatch can't make it go away magically no matter how much you beg them.
mawit still flipping the fuck out because suddenly the great glimmer of hope that today wasn't going to totally suck is being eclipsed by yawning pit of despair.
on last leg of last call partner says something about bart and rides and mawit doesn't get it (because logic while flipping the fuck out? notsomuch.) the Boy calls. what's the deal? The Sainted Partner lays out the plan: The Boy meets mawit at work. The Boy and Mawit drive their car to BART. partner follows. we park our car at BART, hop in partner's car. partner drives us to theatre. (opposite direction of partner's home.)
cleared last call around 7:10. was at theatre by 7:45.
concert = win.
the marmot gets essentially no sleep. Gets to work. boo, work. mawit tired. marit messed up proportions on coffee manufacturing in the morning. mawit sad. mawit gets coffee. things looking up. two calls down...then three...four...five. We're on our way to our sixth call and we drive past the Fox Theatre.
What's on the sign? Sep 23 Rodrigo y Gabriela.
what. WHAT. WHAAAT. mawit thinks "Dammit! I missed them AGAIN! WAIT! 23!!! 23 is TODAY!" grab phone. text mom to beg for info on concert start/price/etc.
starts at 8pm. tickets still available, 35 bucks. HELL. YES. text The Boy: hey remember rod y gab, want to go tonight?"
The Boy gets tickets with four minutes remaining. HELL. YES.
then, enter Murphy. we're delayed at our seventh call. dispatch has given us an eighth call, too, with a 5:30 pickup. PICKUP. mawit flips the fuck out. partner shakes head at mawit. of course we're gonna get a late call. we always get late calls. no, dispatch can't make it go away magically no matter how much you beg them.
mawit still flipping the fuck out because suddenly the great glimmer of hope that today wasn't going to totally suck is being eclipsed by yawning pit of despair.
on last leg of last call partner says something about bart and rides and mawit doesn't get it (because logic while flipping the fuck out? notsomuch.) the Boy calls. what's the deal? The Sainted Partner lays out the plan: The Boy meets mawit at work. The Boy and Mawit drive their car to BART. partner follows. we park our car at BART, hop in partner's car. partner drives us to theatre. (opposite direction of partner's home.)
cleared last call around 7:10. was at theatre by 7:45.
concert = win.
Tuesday, September 22, 2009
Saturday, September 19, 2009
A Faerie Imp Trolly
OH lord, I did NOT need to find this on a day when I'm trying to pretend I don't have to do anything but secretly (se..cret...ly) have waaaay too much stuff to do.
A Feral Item Pylori
Premarital Life Yo
Premarital Leif Yo
Paella Ire Mortify
I think this one's my Pirate Name of the day (it being Talk Like A Pirate Day):
Parlay Foe Limiter
you can apparently make lots of naughty anagrams with my full name.
and I want this shirt.
dresden FTW!
A Feral Item Pylori
Premarital Life Yo
Premarital Leif Yo
Paella Ire Mortify
I think this one's my Pirate Name of the day (it being Talk Like A Pirate Day):
Parlay Foe Limiter
you can apparently make lots of naughty anagrams with my full name.
and I want this shirt.
dresden FTW!
Thursday, September 10, 2009
morngryn fortjener deng.
or, crappy mornings deserve punishment. although combating crappy mornings with Queen is more like a reward...hm.
GOD I love that riff.
and you can't not love that song.
fried chicken!
and, because it's me, and we all know my neuroses (thanks MOM) (nah, just kidding, I like this particular neurosis.)
oh yeah. I think we should replace the statue of liberty with a giant statue of freddie mercury like the one that's in montreaux. colossus of rhodes style.
GOD I love that riff.
and you can't not love that song.
fried chicken!
and, because it's me, and we all know my neuroses (thanks MOM) (nah, just kidding, I like this particular neurosis.)
oh yeah. I think we should replace the statue of liberty with a giant statue of freddie mercury like the one that's in montreaux. colossus of rhodes style.
Sunday, September 06, 2009
chick-en. good!
otherwise known as...comic day!
Good, good book!
good, good book!
oh, xkcd. how is it that you almost perfectly understand my brain?
why does metal feel colder to the touch then wood when they're both outside?
they have different abilities to hold warmth. metal, being colder than your skin, transfers heat faster away from your hand and feels very cold to touch. wood is a bad heat transferer, and takes longer to steal your warmth. that's why it feels warmer to touch!
pff.
don't you believe me? she doesn't believe me! it's true!
wolf, wolf...
WHERE?!
Study again? Pff! If I could go to Hogwarts as Harry Potter and learned magic, I'd have applied there! I would have been able to learn to fly and such! -But to sit still and learn boring things and not be able to glue anyone to their chairs because you're over 20? No thanks! I can't imagine going back to school again. I am after all a grownup.
m-hm.
did you read...
sssh.
don't you think...
hush, you!
I...
seriously. shut up.
I just...
if you force me to discuss the news in these days, you have to pay for my therapy afterwards.
did you know that KISS have made KISS-coffins?
eeeew...Do you know what kind of coffin you want?
Cyan, now...
morbid subject, sorry.
it's not that. I just thought it was obvious. I want a treasure chest, of course.
of course.
(lik = corpse, kiste = chest, skatte = treasure, so coffin = corpse chest, see?)
you musn't say I'm sorry all the time.
I'm sorry.
I mean it! it takes a lot of courage to ask for forgiveness when you've done something wrong, but it's self-deprecating to say it too much!
I'm s- Shaddup.
wise girl.
With ninjalike invisiblity she sneaks herself gradually closer...her sleeping target notices nothing.
AAAARGH!
I HAVE NINJALIKE INVISIBILITY!
YOU HAVE ICE-COLD TOES!
Ow. What's this? today's newspaper? aha. I must have bought it on the way home. But what is this? Toast in the newspaper? aha. I must have made it. What's this now? there's been a robbery at a Burger King? ...aha...
ARGH!
What happened?
I heard sounds and my imagination ran away from me...it's easy to see things when you're in the woods. ...but it was only a guy who wanted to try to rob us. I kicked him in the balls and took his knife. he's not coming back.
...what were you afraid it would be?
the purple teletubby.
from blip. been there.
that's gonna be expensive.
and lastly, go HERE. now. but only if your sound is up and you're not at work. or in a meeting.
Good, good book!what's it about?
everything under the sun! did you know for example that alcohol is a waste product? all alcohol is made of small organisms that eat sugar and crap alcohol! good, good book!
oh, xkcd. how is it that you almost perfectly understand my brain?
why does metal feel colder to the touch then wood when they're both outside?they have different abilities to hold warmth. metal, being colder than your skin, transfers heat faster away from your hand and feels very cold to touch. wood is a bad heat transferer, and takes longer to steal your warmth. that's why it feels warmer to touch!
pff.
don't you believe me? she doesn't believe me! it's true!
wolf, wolf...
WHERE?!
Study again? Pff! If I could go to Hogwarts as Harry Potter and learned magic, I'd have applied there! I would have been able to learn to fly and such! -But to sit still and learn boring things and not be able to glue anyone to their chairs because you're over 20? No thanks! I can't imagine going back to school again. I am after all a grownup. m-hm.
did you read...sssh.
don't you think...
hush, you!
I...
seriously. shut up.
I just...
if you force me to discuss the news in these days, you have to pay for my therapy afterwards.
did you know that KISS have made KISS-coffins?eeeew...Do you know what kind of coffin you want?
Cyan, now...
morbid subject, sorry.
it's not that. I just thought it was obvious. I want a treasure chest, of course.
of course.
(lik = corpse, kiste = chest, skatte = treasure, so coffin = corpse chest, see?)
you musn't say I'm sorry all the time.I'm sorry.
I mean it! it takes a lot of courage to ask for forgiveness when you've done something wrong, but it's self-deprecating to say it too much!
I'm s- Shaddup.
wise girl.
With ninjalike invisiblity she sneaks herself gradually closer...her sleeping target notices nothing.AAAARGH!
I HAVE NINJALIKE INVISIBILITY!
YOU HAVE ICE-COLD TOES!
Ow. What's this? today's newspaper? aha. I must have bought it on the way home. But what is this? Toast in the newspaper? aha. I must have made it. What's this now? there's been a robbery at a Burger King? ...aha...
ARGH!What happened?
I heard sounds and my imagination ran away from me...it's easy to see things when you're in the woods. ...but it was only a guy who wanted to try to rob us. I kicked him in the balls and took his knife. he's not coming back.
...what were you afraid it would be?
the purple teletubby.
from blip. been there. 
that's gonna be expensive.
and lastly, go HERE. now. but only if your sound is up and you're not at work. or in a meeting.
Saturday, August 15, 2009
I'm ba-ack.
Well, my stupid back is finally back to normal and The Incredibly Ridiculously Late Thing can come out of quarantine (I saw a moth. Teh Intarwebs suggests that it's not a clothes or fiber-loving moth, but rather a food-eating moth ((which I also doubt, because all my fuds are stored in containers purchased to repel The Ants Of Death, but whatever)) BUT I'm not taking chances. it's been wrapped up in the freezer for the past several weeks and gone over with a fine toothed comb ((can't wash, otherwise I would.)) and finally ready to be mailed. Ridiculously. Late.
Sometimes my job is a leeeetle inconvenient.
scary back-killing statistics aside. grumblegrumblefreakin'oldtowno-towngrumblegrr. I'd just like to be able to get to the post office....reliably. srsly.
Also, some part of my childhood just went either a) on a totally batshit crazy rampage or b) off to sob in the corner. Why? because there's a campaign to remove the Carl books from libraries.
THE CARL BOOKS. Good Dog Carl, you know? gorgeous illustrations of a wee little bebbie and her guardian rottweiler by Alexandra Day? largely responsible for my early programming towards big puppydogs? best kid's book ever?! (okay, maybe tied with the mouse books. and maurice sendak. and...ok, so there's a lot of 'best kid's book ever'-s. shush.)
because it encourages irresponsible parenting and encourages/indoctrinates young children with dangerous behavior.
What.
(This comic's first panel and this comic are once again pertinent, and as an aside, you should check out the first comic's author's new comic here.)
I shake my head in disbelief. Where are these people getting their drugs, and why aren't they sharing? although, if the drugs are making them go to crazytown I don't think I want them to share.
and finally...just because it never fails to make me smile...
Sometimes my job is a leeeetle inconvenient.
scary back-killing statistics aside. grumblegrumblefreakin'oldtowno-towngrumblegrr. I'd just like to be able to get to the post office....reliably. srsly.
Also, some part of my childhood just went either a) on a totally batshit crazy rampage or b) off to sob in the corner. Why? because there's a campaign to remove the Carl books from libraries.
THE CARL BOOKS. Good Dog Carl, you know? gorgeous illustrations of a wee little bebbie and her guardian rottweiler by Alexandra Day? largely responsible for my early programming towards big puppydogs? best kid's book ever?! (okay, maybe tied with the mouse books. and maurice sendak. and...ok, so there's a lot of 'best kid's book ever'-s. shush.)
because it encourages irresponsible parenting and encourages/indoctrinates young children with dangerous behavior.
What.
(This comic's first panel and this comic are once again pertinent, and as an aside, you should check out the first comic's author's new comic here.)
I shake my head in disbelief. Where are these people getting their drugs, and why aren't they sharing? although, if the drugs are making them go to crazytown I don't think I want them to share.
and finally...just because it never fails to make me smile...
Tuesday, July 21, 2009
dad! what? Dad! What?! DAD! WHAT?!?
ah, Indiana Jones.
I made this one.
yesterday you may have heard a terrifying screech of agony around 8pm. that would have been me removing my eyes with a blunt spoon after the trailer for the new sherlock holmes movie came on the screen. *shudder.*
New Harry Potter was ...kinda boring. although in the theatre last night there were at least two other knitters other than me, because while everyone chuckled at one scene, a few of us laughed pretty loudly.
Matt and I want to see a Dresden movie. but I'd be a bit terrified of a Dresden movie. maybe directed by Tim Burton or Guillermo del Toro or someone who wouldn't kill it. and John Williams to do the scoring. yeah.
I made this one.
yesterday you may have heard a terrifying screech of agony around 8pm. that would have been me removing my eyes with a blunt spoon after the trailer for the new sherlock holmes movie came on the screen. *shudder.*
New Harry Potter was ...kinda boring. although in the theatre last night there were at least two other knitters other than me, because while everyone chuckled at one scene, a few of us laughed pretty loudly.
Matt and I want to see a Dresden movie. but I'd be a bit terrified of a Dresden movie. maybe directed by Tim Burton or Guillermo del Toro or someone who wouldn't kill it. and John Williams to do the scoring. yeah.
Friday, July 17, 2009
Oh so much win. SO. MUCH. WIN.
seriously. Let's check that out again, for all y'all non-norsk-snakkende-folk.
also, I have known all of those people. Went to school with...eyep, all of them. caricatures, yes, but dead-on.
this merely reaffirms my desire- nay, need- to see Kill Buljo.
Monday, July 06, 2009
I HAS YARN!
yarn that I made! see!
Here it is in progress...
and here is my skein! whee!
not sure how many yards, and I still need to set the twist, but....YARN!
also, here's what's next:
From my super awesome Gorey swap partner.
Also...Twister = best movie ever.
Science and pyrotechnics. nothing better.
Here it is in progress...
and here is my skein! whee!
not sure how many yards, and I still need to set the twist, but....YARN!also, here's what's next:
From my super awesome Gorey swap partner.Also...Twister = best movie ever.
Science and pyrotechnics. nothing better.
Wednesday, June 17, 2009
WHEEEEEE!
September the 7th is going to be a great day. An awesome day. A day during which Marit will not be allowed to drive a motorized vehicle. Why?
Because we've already learned that Marit + Rodrigo y Gabriela = full-on PD attack. can't drive and drum at the same time.
And because the new Rodrigo y Gabriela album 11:11 is coming out that day.
So. Much. Awesome.
Because we've already learned that Marit + Rodrigo y Gabriela = full-on PD attack. can't drive and drum at the same time.
And because the new Rodrigo y Gabriela album 11:11 is coming out that day.
So. Much. Awesome.
Saturday, June 13, 2009
he's like a mr wizard for food, but extra cheesy.
A curious thing happens when you watch too many episodes of Good Eats. You start to crave everything you see, even things that don't really seem all that appetizing. (like homemade chicken fried steak...three different ways.) And you start to lust after every single gadget. (like cast iron broilers. and mini spatulae. and squeezy plunger beaker meauring cups. and beakers. and....um...small apartment, marit. small. apart. ment.) And then, you decide that the perfect food to make for dinner tonight is an english rib hungarian goulash...that takes at the minimum something like 10 hours to make...and it's already six o'clock. you briefly consider it anyway.
I call it Food Schizophrenia. I got it bad.
on the plus side, it's keeping me from marching down to my renter's office and demanding money for reparations for all the anguish I've endured dealing with ridiculously fucking shoddy 'renovations' done in my apartment. The painters were clearly trained apes (without the training): my closet doors weren't stripped before they repainted them white, and they didn't take them down when they repainted because there is a strip of old dingy cream hidden above the track, which is also covered in blobs of paint, and the hardware hanging the doors is completely covered with paint so a 2 minute rehanging job turned into 40 solid minutes of angry pounding and drilling...nor were the chipped edges of walls treated before they were repainted, so in places the metal framing edges are covered only by a coat of paint, they painted completely over the fuse box...and I'm pretty sure the walls are painted in primer.
dammit. now I need to go watch more Good Eats.
Tuesday, June 09, 2009
might?
marit freya's Dewey Decimal Section:
512 Algebra
marit freya's birthday: 5/29/1983 = 529+1983 = 2512
Class:
500 Science
Contains:
Math, astronomy, prehistoric life, plants and animals.
What it says about you:
You are fascinated by the world around you, and see it as a puzzle worth exploring. You try to understand how things work and how you can make them better. You might be a nerd.
Find your Dewey Decimal Section at Spacefem.com
...I just used a meme that told me what my dewey decimal would be. I think any question about my being a nerd is moot.
Sunday, June 07, 2009
laughing so hard I'm crying.
seriously.
I love XKCD. LOVE. oh, Mr Munroe, you are a genius. Friday's was awesome:
but this one...might be the turning point behind me getting that Height poster I keep eyeing, or the Stand Back: I'm Going to Try Science! shirt, or the SCIENCE It works, bitches. shirt.
and there is a killer pillow on ravelry that I want, although I want it to be this panel instead, which is somewhat more complistercated.
I love XKCD. LOVE. oh, Mr Munroe, you are a genius. Friday's was awesome:
but this one...might be the turning point behind me getting that Height poster I keep eyeing, or the Stand Back: I'm Going to Try Science! shirt, or the SCIENCE It works, bitches. shirt.
and there is a killer pillow on ravelry that I want, although I want it to be this panel instead, which is somewhat more complistercated.
Monday, June 01, 2009
Movies Part Deux.
Night at the Museum 2 is not nearly as entertaining as Night at the Museum. (Also, Amy Adams as Amelia Erhart is kinda creepy.) But sufficently entertaining enough that I didn't fall back on my usual reaction to Ben Stiller. (clawing off my face screaming incoherently Oh God The Pain...although if I'm screaming oh god the pain is it really incoherent? maybe for you. I know I'm showing my alien heritage in expressing that sentiment...but...really...Zoolander. need I say more?)
Star Trek is still pretty freakin' cool. Not as cool on non-Imax (even halfassed Imax), however, so if you can hit up the Imax, do so. you may be able to discern individual nosehairs, but the forebrain will be going "oo....shiny....." enough to make up for it.
Did I see any new previews? um...oh. yeeeees. Hollywood is so starved for ...I don't know what... that they're actually making another alvin and the chimpunks movie. I don't remember anything else, the alvin scared it away.
Star Trek is still pretty freakin' cool. Not as cool on non-Imax (even halfassed Imax), however, so if you can hit up the Imax, do so. you may be able to discern individual nosehairs, but the forebrain will be going "oo....shiny....." enough to make up for it.
Did I see any new previews? um...oh. yeeeees. Hollywood is so starved for ...I don't know what... that they're actually making another alvin and the chimpunks movie. I don't remember anything else, the alvin scared it away.
Tuesday, May 26, 2009
Movies...
Star Trek:
Awesome. Went to a matinee, but would have willingly paid a) actual movie prices b) actual imax prices and even c) actual imax prices at a real imax (not AMC's stupid I'm-an-imax-but-actually-not-really-teehee-suckers) in California. It reminded me of when I was younger and running around with Dithy and Teri debating whether Riker or Picard was better (as I recall Teri voted Riker and Dithy voted Picard) and adding to the Weirdo Chant and all manner of ridiculously awesome things. Am quite willing to see it again.
Terminator Salvation:
Terminatedest? oh wait, that's Die Hardester. Wrong franchise. Pretty good. Although at times I think Christian Bale forgot he wasn't being Batman and started to talk in the Batman voice. I can well understand why he could go into crazy flipout mode, especially during certain scenes. Watching the credits roll in the beginning was sort of entertaining, kind of like when the credits rolled at the end of Star Trek and everyone in the theatre said Winona Ryder?! WTF!? Also: I never ever ever ever want to see the governor of my state bare-ass naked on a giant fucking screen ever again. I don't care if he's digital. EW.
Angels and Demons:
Pretty good. I was very very disappointed when the credits in the beginning were rolling and then the title splash screen came on...and it wasn't the Angels and Demons ambigram. hello? whole damn book is based around ambigrams, and you give me a stupid boring text title? Also, totally gratuitous extended Tom Hanks-in-a-Speedo scene. Dudes. Ew.
In terms of previews:
Public Enemies looks good. (is Christian Bale in every movie?)
O You who are responsible for that heresy that is Sherlock Holmes? you're headed straight to the 9th circle of hell. seriously. Someone find a way to harness the energy caused by Sir Arthur Conan Doyle turning in his grave. Mr Downey Jr? Jeremy Brett is coming for you. he's coming back from the dead for you, and he's going to kick. your. ass. and I'm going to cheer him on. omgwtfbbq. There's not enough -OH groups in the world to make me go see that movie.
Julie and Julia could be entertaining.
The Sandra Bullock movie could also be entertaining. it's quite likely that all the funny bits are in the preview, but they're pretty funny bits.
Night at the Museum could be funny. The first one was surprisingly good, and I am usually heavily allergic to Ben Stiller.
Don't know about Up.
Land Of The Lost: ....Will Farrell...please...go...away...please...
Taking of Pelham 123: ...John Travolta is creeeeeepy.
Year One is another one of those weeeeelll...maybe....could be good, could be Zoolander.
I can't remember any others.
Oh but the nurse on the new showtime tv series? her twin works at one of my hospitals. (yes, *my* hospitals.)
Awesome. Went to a matinee, but would have willingly paid a) actual movie prices b) actual imax prices and even c) actual imax prices at a real imax (not AMC's stupid I'm-an-imax-but-actually-not-really-teehee-suckers) in California. It reminded me of when I was younger and running around with Dithy and Teri debating whether Riker or Picard was better (as I recall Teri voted Riker and Dithy voted Picard) and adding to the Weirdo Chant and all manner of ridiculously awesome things. Am quite willing to see it again.
Terminator Salvation:
Terminatedest? oh wait, that's Die Hardester. Wrong franchise. Pretty good. Although at times I think Christian Bale forgot he wasn't being Batman and started to talk in the Batman voice. I can well understand why he could go into crazy flipout mode, especially during certain scenes. Watching the credits roll in the beginning was sort of entertaining, kind of like when the credits rolled at the end of Star Trek and everyone in the theatre said Winona Ryder?! WTF!? Also: I never ever ever ever want to see the governor of my state bare-ass naked on a giant fucking screen ever again. I don't care if he's digital. EW.
Angels and Demons:
Pretty good. I was very very disappointed when the credits in the beginning were rolling and then the title splash screen came on...and it wasn't the Angels and Demons ambigram. hello? whole damn book is based around ambigrams, and you give me a stupid boring text title? Also, totally gratuitous extended Tom Hanks-in-a-Speedo scene. Dudes. Ew.
In terms of previews:
Public Enemies looks good. (is Christian Bale in every movie?)
O You who are responsible for that heresy that is Sherlock Holmes? you're headed straight to the 9th circle of hell. seriously. Someone find a way to harness the energy caused by Sir Arthur Conan Doyle turning in his grave. Mr Downey Jr? Jeremy Brett is coming for you. he's coming back from the dead for you, and he's going to kick. your. ass. and I'm going to cheer him on. omgwtfbbq. There's not enough -OH groups in the world to make me go see that movie.
Julie and Julia could be entertaining.
The Sandra Bullock movie could also be entertaining. it's quite likely that all the funny bits are in the preview, but they're pretty funny bits.
Night at the Museum could be funny. The first one was surprisingly good, and I am usually heavily allergic to Ben Stiller.
Don't know about Up.
Land Of The Lost: ....Will Farrell...please...go...away...please...
Taking of Pelham 123: ...John Travolta is creeeeeepy.
Year One is another one of those weeeeelll...maybe....could be good, could be Zoolander.
I can't remember any others.
Oh but the nurse on the new showtime tv series? her twin works at one of my hospitals. (yes, *my* hospitals.)
Thursday, May 21, 2009
Spiders.
There are no brown recluses in California. I've lived in the heart of recluse-dom and never encountered one. Black widows we got, though, in spades, though I haven't seen one here yet.
There are, however, GIANT FREAKING SPIDERS IN MY HOUSE.
So I'm checking my email and the cat bowl starts whining that it's out of water and the pump's running dry. I unplug the fountain-the italics will make sense here in a second-and go fill it. I return, fiddle with the dome until it sits right, then go to plug in the fountain. Huh, there's a dark blob on the bottom edge of the outlet plate. cat poo? no. dust bunny? no. what is- HOLY SHIT HUGE SPIDER. I call The Boy, who comes grudgingly* in.
The Boy: WHAT THE HELL IS THAT?! is that a black widow?
Me: uh...no.
The Boy: are you sure?
Me: uh...yeah. pretty damn hard to confuse a spindly shiny black little-head-giant-teardrop-abdomen with THE SPIDER OF FUCKING DEATH. (I am dramatically re-enacting this part. I just said yes.)
The Boy: holy shit that's big.
Me: Yeah. don't kill it yet I want to get a picture.
...so the cats seem to have kidnapped my little card reader thing (it is moments like this when I wish The Beast were still alive.) so I can't post the picture I took, which is probably OK because it wasn't the greatest of photos. Anyway. IT. WAS. BIG.
and now, I have to try to sleep...with two thoughts in my head.
1) how the hell did Monster Spider get in my house?
2) where the hell are his buddies?
*I am a cool cucumber when it comes to spiders outside my house. in the great outdoors, I am even fine as long as said spider stays off my person. (....and as long as I don't walk face first into a freakin' three-foot-wide garden spider web.) In my house, however, I am your stereotypical squeaky shivery omggetitoffgetitoffkillitkillitkillitkillitkillit girl climbing on chairs. Thus it is usual for The Boy to just say "so kill it," before eventually relenting and saving me from the horrible beast. I'm sure he's confused as to how exactly I made it through Entomology. (simple. Entomology =/= Arachnology.)
There are, however, GIANT FREAKING SPIDERS IN MY HOUSE.
So I'm checking my email and the cat bowl starts whining that it's out of water and the pump's running dry. I unplug the fountain-the italics will make sense here in a second-and go fill it. I return, fiddle with the dome until it sits right, then go to plug in the fountain. Huh, there's a dark blob on the bottom edge of the outlet plate. cat poo? no. dust bunny? no. what is- HOLY SHIT HUGE SPIDER. I call The Boy, who comes grudgingly* in.
The Boy: WHAT THE HELL IS THAT?! is that a black widow?
Me: uh...no.
The Boy: are you sure?
Me: uh...yeah. pretty damn hard to confuse a spindly shiny black little-head-giant-teardrop-abdomen with THE SPIDER OF FUCKING DEATH. (I am dramatically re-enacting this part. I just said yes.)
The Boy: holy shit that's big.
Me: Yeah. don't kill it yet I want to get a picture.
...so the cats seem to have kidnapped my little card reader thing (it is moments like this when I wish The Beast were still alive.) so I can't post the picture I took, which is probably OK because it wasn't the greatest of photos. Anyway. IT. WAS. BIG.
and now, I have to try to sleep...with two thoughts in my head.
1) how the hell did Monster Spider get in my house?
2) where the hell are his buddies?
*I am a cool cucumber when it comes to spiders outside my house. in the great outdoors, I am even fine as long as said spider stays off my person. (....and as long as I don't walk face first into a freakin' three-foot-wide garden spider web.) In my house, however, I am your stereotypical squeaky shivery omggetitoffgetitoffkillitkillitkillitkillitkillit girl climbing on chairs. Thus it is usual for The Boy to just say "so kill it," before eventually relenting and saving me from the horrible beast. I'm sure he's confused as to how exactly I made it through Entomology. (simple. Entomology =/= Arachnology.)
Sunday, May 17, 2009
I have abby-someone cats.
Raz: why is box making funny noises?
Jayne: I can't get out of the box!!1! I CAN'T GET...oh wait. I claim this as my box.
Raz: ZOMG strange cat kill-oh, it's you.
Jayne: *bap*
Raz: what's this? I'll bite it. mmm, cardboard. ZOMG STRANGE CAT-oh, it's you.
Jayne: what's that? umf, my box is little. oo, shiny...slobber HEY you bit me.
Raz: now it's my box. can I fit in my box?
Jayne: no, mine.
Raz: MINE.
Jayne: fine, I don't want it anyway.
Raz: well I don't want it more. *huff*
happy 17. mai!
...you know, if I were here right now? it would be a lot cooler. it's about 12 degrees C. (54 ish F.) but probably just as light. even though it's almost 2300.
yay, midnattsolen. also, guess what I love about this weather map-
did you get it? the little partly cloudy symbols change from a sun to a moon as you go further south. ehehehe. also, poor Christian's getting rained on. looks like Kjersti's got sun though.
but yes! happy 17. mai and happy birthday craig ferguson. happy bay to breakers, which apparently this year will not have any nudity or keggers. riiight. I was going to go watch but dude...it's hot. way too hot to do anything of substance.
must...gain...energy...to...clean...fridge...wait, the fridge is cold. ok, I can handle that.
yay, midnattsolen. also, guess what I love about this weather map-
did you get it? the little partly cloudy symbols change from a sun to a moon as you go further south. ehehehe. also, poor Christian's getting rained on. looks like Kjersti's got sun though.but yes! happy 17. mai and happy birthday craig ferguson. happy bay to breakers, which apparently this year will not have any nudity or keggers. riiight. I was going to go watch but dude...it's hot. way too hot to do anything of substance.
must...gain...energy...to...clean...fridge...wait, the fridge is cold. ok, I can handle that.
Saturday, May 16, 2009
brain filtered for your safety.
from Mythtickle:
DADA!!!!! ehehehehehehe.
From the awesome Girl Genius:
eeeeebil social scientists. are there really any other kind?
more nemi! (that's a link to a newspaper, I can't seem to find a home site for Lise Myhre.)
That is the worst thing I have read....but now at least there aren't any more dustmites here!
:) oh, Hod.
DADA!!!!! ehehehehehehe.From the awesome Girl Genius:
eeeeebil social scientists. are there really any other kind?more nemi! (that's a link to a newspaper, I can't seem to find a home site for Lise Myhre.)
That is the worst thing I have read....but now at least there aren't any more dustmites here!I am very good.
why's that?
:) oh, Hod.
Saturday, May 09, 2009
Man....
...I really want another tattoo. *sigh* Or maybe I just need to stop looking at ones like these: I mean...heckel? awesome? although I'd prefer some of Leuckart's stuff. and...oh, paleontology, one of my first loves...
but first....need money. money not earmarked for more important things. and need some printable temp tattoo paper.
but first....need money. money not earmarked for more important things. and need some printable temp tattoo paper.
Thursday, May 07, 2009
hell yes.
Thanks for signing my petition for the environment! We need as many people as possible to take a stand for our world.
We've got to- it's the only planet I know of with longhaired men and chocolate.
Saturday, May 02, 2009
happy belated may day.
Just got home from X-Men Origins: Wolverine. The Boy said that it was 'okay.' I thought it was pretty good, but then Hugh Jackman spent pretty much the entire movie shirtless. I can forgive a lot of plot mistakes/special effect mistakes for certain concessions. Usually. Troy's at the limit.
I was going to post this on the appropriate day but I forgot. so...belated April Fool's Day, too.
I was going to post this on the appropriate day but I forgot. so...belated April Fool's Day, too.
Luther professor wins role as Dumbledore
Date 4/1/2003 12:00 AM | Topic: NewsWarner Brothers Pictures announced this week that Fred Nyline, Luther College Professor of Music and director of Luther's bands, is to replace the late Irish actor Richard Harris in the role of Albus Dumbledore in the Harry Potter franchise.
"The death of Richard Harris left pretty big magical shoes to fill," said Chris Columbus, director of the first two Potter films. "He became an icon for children around the world. At first we thought that replacing Harris would be a problem, as children would be comparing the new Dumbledore to the old one," Columbus added. "The executives at Warner knew that the actor we chose had to be perfect; we could not afford to fail."
"I really didn't expect to get it," said Nyline, "my grandchildren made me do the audition. I'd do anything for those kids."
Nyline is no stranger to the screen. He starred in the original 1947 production of "Miracle on 34th Street" as Santa Clause. He is also a veteran of major movie franchises, having played the British super-spy James Bond three times in the late 1960s.
As part of the audition process, Nyline had to meet with Harry Potter author J.K. Rowling. Rowling had dismissed other popular choices for Dumbledore such as Sir Ian Mckellan, who played the mighty Gandalf in the "Lord of the Rings" franchise. "Ian just didn't do it for me," Rowling said. "Don't get me wrong, he's great, but I really didn't think he captured the true spirit of Dumbledore. When Fred walked into my office, I knew immediately that he was the one. He is everything Dumbledore is. He's just so darned adorable! Kids will love him."
Children everywhere are responding very positively to Nyline. British children are already discarding their Richard Harris inspired Dumbledore dolls for the new line modeled after Nyline.
"Being an action figure is strange," Nyline told David Letterman during a Late Show appearance. "The kids back at Luther love it though. For my students, it's not much of a stretch to see me hold a magic wand. I conduct the band with a wand-like baton everyday."
Being a movie star has changed very little for Nyline. "He's like Superman!" exclaimed tuba player Tim Arnold ('04). "Even though he's Dumbledore now, he's still directing the band, and still dolling out the same wisdom he always has. Just the other day, before he flew off for another day of Potter filming he reminded us, 'Stay out of work, stay out of trouble, stay out of jail.' What a guy!"
Nyline is slated to portray the great wizard for the next five films, and regardless of the grueling filming schedule, he intends to keep on directing the bands at Luther. "Everything I do, I do for the kids. Being Dumbledore is just one more wonderful thing I can do for children everywhere."
Luther College is very excited for its distinguished faculty member. "This will attract a lot of students to Luther," says President Richard Torgerson. "Everyone will want to be in Dumbledore's band."
Frank Vomis
Chips Freek Editor
Thursday, April 30, 2009
oooowwwwwwwwwie.
ow. I has hurt. (like ich habe hunger-unger-unger-unger, only more painful and less melodic.)
why has I hurt? Well, Le Marmot went for a run yesterday. (a jog. Le Marmot does not likey the runny. Why does Le Marmot not likey the runny? take the contents of a 16 or so ounce can and put them in a plastic baggie. repeat with another can's contents. now put on a bra and insert baggies. now go run.) Le Marmot also doesn't likey the runny because she's not in the best of shape, if we're being honest. but mostly: boobs. ow. if someone has Teh Miracle Bra please tell me because my sports bra just gives me one floppy uniboob.
Then, Le Marmot did some yoga/strength training on the Wiifit.
that was yesterday.
Today, I got to spend an entire call holding an IV bag over my head, because our gurneys don't have IV poles (because they all got stolen from our station and sent into the city) and because for some reason they didn't mount a hook on our rig. (Like they didn't mount an EMT-catcher, which is my favorite thing evar. not. especially when we're on the freeway. hit the brakes too fast or swerve and I'm eating cabinets. with my face. woo. hoo.)
and then we had a stair chair call. (hey, you guys wanna run one more call? pretty please? it's a discharge and it's only 3 miles away? sure, we'll run it. ok great! um...there's stairs, do you have a stair chair? ....grmblersgrnfrazzer yes.)
now I feel like Kronk in Emperor's New Groove: "back elbows shoulders *thud*"
Also, question: how in the hell do you interpret this:
For the holy spirit and we ourselves have favored adding no further burden to YOU, except these necessary things, to keep abstaining from things sacrificed to idols and from blood and from things strangled and from fornication. If YOU carefully keep yourselves from these things, YOU will prosper. Good health to YOU!” (acts 15:28-29)
which is the same as this:
For it seemed good to the Holy Ghost, and to us, to lay upon you no greater burden than these necessary things; That ye abstain from meats offered to idols, and from blood, and from things strangled, and from fornication: from which if ye keep yourselves, ye shall do well. Fare ye well.
to mean blood transfusions = evil?
and also...why is YOU capitalized everywhere, but yourselves isn't? shouldn't it be if YOU carefully keep YOURSELVES? ...skippy. box. now.
why has I hurt? Well, Le Marmot went for a run yesterday. (a jog. Le Marmot does not likey the runny. Why does Le Marmot not likey the runny? take the contents of a 16 or so ounce can and put them in a plastic baggie. repeat with another can's contents. now put on a bra and insert baggies. now go run.) Le Marmot also doesn't likey the runny because she's not in the best of shape, if we're being honest. but mostly: boobs. ow. if someone has Teh Miracle Bra please tell me because my sports bra just gives me one floppy uniboob.
Then, Le Marmot did some yoga/strength training on the Wiifit.
that was yesterday.
Today, I got to spend an entire call holding an IV bag over my head, because our gurneys don't have IV poles (because they all got stolen from our station and sent into the city) and because for some reason they didn't mount a hook on our rig. (Like they didn't mount an EMT-catcher, which is my favorite thing evar. not. especially when we're on the freeway. hit the brakes too fast or swerve and I'm eating cabinets. with my face. woo. hoo.)
and then we had a stair chair call. (hey, you guys wanna run one more call? pretty please? it's a discharge and it's only 3 miles away? sure, we'll run it. ok great! um...there's stairs, do you have a stair chair? ....grmblersgrnfrazzer yes.)
now I feel like Kronk in Emperor's New Groove: "back elbows shoulders *thud*"
Also, question: how in the hell do you interpret this:
For the holy spirit and we ourselves have favored adding no further burden to YOU, except these necessary things, to keep abstaining from things sacrificed to idols and from blood and from things strangled and from fornication. If YOU carefully keep yourselves from these things, YOU will prosper. Good health to YOU!” (acts 15:28-29)
which is the same as this:
For it seemed good to the Holy Ghost, and to us, to lay upon you no greater burden than these necessary things; That ye abstain from meats offered to idols, and from blood, and from things strangled, and from fornication: from which if ye keep yourselves, ye shall do well. Fare ye well.
to mean blood transfusions = evil?
and also...why is YOU capitalized everywhere, but yourselves isn't? shouldn't it be if YOU carefully keep YOURSELVES? ...skippy. box. now.
Sunday, April 26, 2009
Haven't done this in awhile.
| Your Life: The Soundtrack Created by aiko and taken 167054 times on Bzoink | |
| Opening credits: | Star Wars Theme (techno remix) |
| Waking up: | She Blinded Me With Science! (Thomas Dolby) |
| Average day: | Vi Krangler (De Lillos) |
| First date: | Sigur Ros (Sigur Ros) |
| Falling in love: | Prime Audio Soup (Meat Beat Manifesto) |
| Love scene: | Contact (Rent Original Broadway Cast) |
| Fight scene: | Bach's Fantasie in C Maj BWV 570 (Empire Brass and Bill Kuhlman Baroque Music for Brass and Organ) |
| Breaking up: | One Headlight (The Wallflowers) |
| Getting back together: | Hår Som Spunnid Gull (Lumsk) |
| Secret love: | Hver Gang Jeg Går Rund Her (Postgirobygget) |
| Life's okay: | Dirty Dancing (Black Eyed Peas) |
| Mental breakdown: | Bak Et Halleluja (Kaizers Orchestra) |
| Driving: | Tamacun (Rodrigo y Gabriela) |
| Learning a lesson: | The Happiest Days of Our Lives (Pink Floyd) |
| Deep thought: | Gia Sena (Elli Kokkinou) |
| Flashback: | The Climb (No Doubt) |
| Partying: | Juta (Georgia State Dance Company Orchestra) |
| Happy dance: | Eye Patch (Robert Rodriguez/Once Upon A Time In Mexico) |
| Regreting: | Marillion (Paul Oakenfold) |
| Long night alone: | Don't Speak (No Doubt) |
| Death scene: | Gjendines Bånsull |
| Closing credits: | Cambodia -Fragma Remix (Pulsedriver) |
| You've been totally Bzoink*d! Take This Survey | Search Surveys | Create a Survey  | |
Waking up is quite likely. My fight scene...seems a little strange. I think Breaking Up and Getting Back Together are backwards.
Friday, April 24, 2009
Got out of town on a boat for the southern islands...
I stole this from Pixiethief, who stole it from someone else in turn.
01. Make a list of 5 things you can see:
1.) Kittens attempting to kill each other
2.) the project bin that's achieved sentience (or at least sexual maturation. it's breeding. trust me. that half-spun green fleece was not there yesterday.)
3.) My poor lily-of-the-valley plant that needs water.
4.) the nerdiest guitar hero guitar ever.
5.) The wiifit, which is frowning in disapproval at me.
02. WHAT'S THE FIRST SCAR YOU EVER GOT?
The bump on my lip and eyebrow slice from faceplanting onto an ice slide in 4th grade is the earliest thing I remember. (They match nicely with the scar from sticking a braces bracket through my lip faceplanting off a 60-in play ball, which lines up perfectly with the scar from faceplanting into a slate-bottomed stream (sensing a theme? hey, at least I saved the camera!*) and makes it sort of look like I was in a knife fight.) I'm sure I have something from earlier. Mom?
03. Is there anything in your fridge right now that you would never eat/drink?
Matt's French's mustard. *shudder*
04. What's your occupation?
Sir/Ma'am-I'm-an-EMT-can-I-help-you?
05. Do you nap a lot?
Not really. I tend to need more than 3 hours or less than 10 minutes. I do a lot of middle-distance staring, though, which might count.
06. What was your first celebrity crush?
Adrian Paul. or Johnny Depp. But most likely Adrian Paul.
07. What's your current fandom/obsession/addiction?
Firefly, making sure the eel is still alive, iced espresso con panna from the little italian cafe, the next Dresden book.
08. What are you listening to right now?
Bill Maher.
09. What was the last text message you received?
Something from Mom, I think.
10. What websites do you always visit when you go online?
Gmail, Ravelry, several webcomics.
11. What was the last thing you bought?
Saline.
12. Cutest thing you have seen today?
Raz pleading for my ice cream.
13. Does the weather affect your mood?
not usually. unless it's snowing. then I get ridiculously happy. Snow!
14. What is your zodiac sign?
Gemini
15. Pets?
Jayne, the box dropping man ape gone wrong kitty, and Raziel, the crazy psycho jungle kitty that I wanted to name Mister since he's huge and grey, but The Boy wasn't interested. two bettas, a goldfish named Aurelius, an african dwarf frog named La Grenouille, an eel named Amore, and a smattering of white cloud minnows, blue danios, and longfin cherry barbs.
16. A saying you live by/that you have remembered and has inspired you?
From Mr Nyline (my band director at Luther, said after every band rehearsal.):
Stay out of work, stay out of trouble, stay out of jail. (sometimes he ended with "Stay hungry.")
17. What is the story behind your username?
I think it was james or xander who first started calling me marmot, which is one of the few nicknames that stuck, and I knit, so...marmotknit. (my old lj was picklechild, which has a long and mostly-inappropriate backstory involving the renaissance festival and the pickle sellers.)
18. What's something you'd like to say to someone right now?
I caaaaan't take any more songs with the word 'shawtie' in it. OMGMAKEITSTOP.
19. What are your plans for next weekend?
not sure yet. The Boy has to work, so probably nothing exciting.
20. Say something to the person who tagged you:
rather existential since no one tagged me.
*so I'm towards the rear of my classmates, and we're sprawled over a wide swath of vidda hiking back to civilization, and I'm fording a stream. For the record, slate + a few inches of really cold water = slippery rocks that slide around amongst themselves. I slip. My camera is around my neck and one shoulder, standard carry position, and as I'm falling I take it in one hand to keep it out of the water or from being smashed between me and the rocks. This leaves me with one hand to stop me and my giant-ass purple pack from going splat. I retain the presence of mind to not stop myself with an outstretched hand, and smack the ground. Ow. Get up, inspect camera- a little bend on the filter edge, but that's ok. why does my lip hurt? *prod* oh, look, lots of blood. I look up and Levi is standing next to me, observing the events of the past few seconds. he hands me a cloth of some ilk, then steps back and shakes his head slightly, saying only "...Foto." (the shorthand for our photography class.) Four stitches (sans novocaine! OW bloody OW!) and I'm impersonating angelina jolie for a week.
01. Make a list of 5 things you can see:
1.) Kittens attempting to kill each other
2.) the project bin that's achieved sentience (or at least sexual maturation. it's breeding. trust me. that half-spun green fleece was not there yesterday.)
3.) My poor lily-of-the-valley plant that needs water.
4.) the nerdiest guitar hero guitar ever.
5.) The wiifit, which is frowning in disapproval at me.
02. WHAT'S THE FIRST SCAR YOU EVER GOT?
The bump on my lip and eyebrow slice from faceplanting onto an ice slide in 4th grade is the earliest thing I remember. (They match nicely with the scar from sticking a braces bracket through my lip faceplanting off a 60-in play ball, which lines up perfectly with the scar from faceplanting into a slate-bottomed stream (sensing a theme? hey, at least I saved the camera!*) and makes it sort of look like I was in a knife fight.) I'm sure I have something from earlier. Mom?
03. Is there anything in your fridge right now that you would never eat/drink?
Matt's French's mustard. *shudder*
04. What's your occupation?
Sir/Ma'am-I'm-an-EMT-can-I-help-you?
05. Do you nap a lot?
Not really. I tend to need more than 3 hours or less than 10 minutes. I do a lot of middle-distance staring, though, which might count.
06. What was your first celebrity crush?
Adrian Paul. or Johnny Depp. But most likely Adrian Paul.
07. What's your current fandom/obsession/addiction?
Firefly, making sure the eel is still alive, iced espresso con panna from the little italian cafe, the next Dresden book.
08. What are you listening to right now?
Bill Maher.
09. What was the last text message you received?
Something from Mom, I think.
10. What websites do you always visit when you go online?
Gmail, Ravelry, several webcomics.
11. What was the last thing you bought?
Saline.
12. Cutest thing you have seen today?
Raz pleading for my ice cream.
13. Does the weather affect your mood?
not usually. unless it's snowing. then I get ridiculously happy. Snow!
14. What is your zodiac sign?
Gemini
15. Pets?
Jayne, the box dropping man ape gone wrong kitty, and Raziel, the crazy psycho jungle kitty that I wanted to name Mister since he's huge and grey, but The Boy wasn't interested. two bettas, a goldfish named Aurelius, an african dwarf frog named La Grenouille, an eel named Amore, and a smattering of white cloud minnows, blue danios, and longfin cherry barbs.
16. A saying you live by/that you have remembered and has inspired you?
From Mr Nyline (my band director at Luther, said after every band rehearsal.):
Stay out of work, stay out of trouble, stay out of jail. (sometimes he ended with "Stay hungry.")
17. What is the story behind your username?
I think it was james or xander who first started calling me marmot, which is one of the few nicknames that stuck, and I knit, so...marmotknit. (my old lj was picklechild, which has a long and mostly-inappropriate backstory involving the renaissance festival and the pickle sellers.)
18. What's something you'd like to say to someone right now?
I caaaaan't take any more songs with the word 'shawtie' in it. OMGMAKEITSTOP.
19. What are your plans for next weekend?
not sure yet. The Boy has to work, so probably nothing exciting.
20. Say something to the person who tagged you:
rather existential since no one tagged me.
*so I'm towards the rear of my classmates, and we're sprawled over a wide swath of vidda hiking back to civilization, and I'm fording a stream. For the record, slate + a few inches of really cold water = slippery rocks that slide around amongst themselves. I slip. My camera is around my neck and one shoulder, standard carry position, and as I'm falling I take it in one hand to keep it out of the water or from being smashed between me and the rocks. This leaves me with one hand to stop me and my giant-ass purple pack from going splat. I retain the presence of mind to not stop myself with an outstretched hand, and smack the ground. Ow. Get up, inspect camera- a little bend on the filter edge, but that's ok. why does my lip hurt? *prod* oh, look, lots of blood. I look up and Levi is standing next to me, observing the events of the past few seconds. he hands me a cloth of some ilk, then steps back and shakes his head slightly, saying only "...Foto." (the shorthand for our photography class.) Four stitches (sans novocaine! OW bloody OW!) and I'm impersonating angelina jolie for a week.
because every so often...
...you just need some firefly.
I have a ranty but I'm too tired to be coherent or fair. so maybe tomorrow. For now, Firefly.
Mal: If anyone gets nosy, just, you know, shoot 'em.
Zoe: Shoot 'em?
Mal: Politely.
Mal: See, this is a sign of your tragic space dementia. All paranoid and crotchety, it breaks the heart.
Mal: "This isn't happening." (to Saffron) "Will you stop crying?"
Inara: "Oh, for God's sake, Mal, can you be a human being for thirty seconds?"
Wash: "Speaking as one married man to another..."
Mal: "I am not married!" (to Saffron) "I'm sorry. You don't shame me, you have very nice qualities but I didn't ever marry you."
Book: (holding encyclopedia) "I believe you did. Last night." (Mal hesitates, steps toward Jayne
Mal: (to Jayne, quiet) "How drunk was I last night?"
Jayne: "I dunno, I passed out."
Zoe: Sir, I think you have a problem with your brain being missing.
Wash: "Don't fall asleep now. Sleepiness is weakness of character. Ask anyone! You're acting captain. Know what happens you fall asleep now?"
Zoe: "Jayne slits my throat and takes over."
Wash: "That's right."
Zoe: "And we can't stop it."
Wash: "Well, I wash my hands of it. It's a hopeless case. I'll read a nice poem at the funeral. Something with imagery."
Zoe: "You could lock the door and keep the power-hungry maniac at bay."
Wash: "Oh, no, I'm starting to like this poetry idea now. 'Here lies my beloved Zoe, my autumn flower, somewhat less attractive now she's all corpsified and gross'..."
Zoe: Planet's coming up a might fast.
Wash: Just means I'm going down too quick. Likely crash and kill us all.
Mal: That happens, let me know.
Mal: Define 'interesting.'
Wash: "Oh God, Oh God, we're all gonna die?"
Wash: You want a slinky dress? I can buy you a slinky dress. Captain, can I have money for a slinky dress?
Jayne: I'll chip in.
Zoe: I can hurt you.
Kaylee: These girls have the most beautiful dresses. And so do I, how 'bout that!
Mal: Well, careful with it. We cheated Badger outta good money to buy that frippery. You're supposed to make me look respectable.
Kaylee: Yes sir, Captain Tightpants.
Jayne: We need a di-version. I say Zoe gets nekkid.
Wash: Nope.
Jayne: I could get nekkid.
Simon/Zoe/Wash: No!
Badger: "Why ain't she talking? She's got a secret."
River: "Sure, I got a secret. More'n one. Don't seem likely I'd tell them t'you, now, do it? Anyone off Dyton Colony knows better'n t'talk t'strangers. You're talkin' loud enough for the both of us, though, en't'ya? I've known a dozen like you. Skipped off home early. Run graft jobs 'ere and there. Spent some time in the lockdown, but less'n you claim. Now you're what? Petty thief with illusions of standing? Sad little king of a sad little hill."
Badger: "...Nice to see someone from the old homestead."
River: "Not really." (to Simon) "Call me if anyone interesting shows up."
Badger: "I like her."
Jayne: "That right there? Exactly the kind of di-version we coulda used."
Mal: How can you say that? How can you shame me in front of new people?
Jayne: If I could make you prettier, I would.
Mal: You are not the man I met a year ago.
River: Noah's Ark is a problem.
Book: Really.
River: We'll have to call it early quantum state phenomenon. Only way to fit five thousand species of mammal on the same boat.
River: Also, I can kill you with my brain.
Mal: "And Kaylee, what the hell's goin' on in the engine room? Were there monkeys? Some terrifying space monkeys maybe got loose?"
Simon: My sister's a ship. We had a fairly complicated childhood.
Jayne: "Well, I say as a rule that girlfolk ain't to be trusted." River: "Jayne is a girl's name."
Mal: "I hate to bring up our imminent arrest during your crazy time, but we gotta move."
Zoe: "River, honey? He's putting the hair away now." River: "It'll still be there... waiting...."
Jayne Cobb: I once hit a guy in the neck from 500 yards with a bent scope. Don't that count upstairs?
Book: Oh, it'll be taken into consideration.
Jayne Cobb: You made that sound kinda ominous.
Jayne: "Anyone remember her coming at me with a butcher knife?"
Wash: "Wacky fun..."
Jayne: "You want to go, little man?"
Wash: "Only if it's someplace with candlelight."
Zoe: "Sir, I know she's unpredictable, but I don't think she'd harm anyone.
Jayne: "Butcher's knife?!"
Zoe: "Anyone we can't spare."
Inara: "Every well-bred petty crook knows -- the small concealable weapons always go to the far left of the place setting."
Mal: Try to see past what she is, on to what she can be.
Zoë: What's that, sir?
Mal: Freedom, is what.
Zoë: [pointing] No, I meant — what's that?
Mal: Oh. Just step around it. I think something must've been living in here.
Zoë: Get her running again?
Mal: Yeah.
Zoë: So...not running now?
Mal: Not so much.
Jayne: "You know what the chain of command is? It's the chain I go get and beat you with until you understand who's in ruttin' command here. (beat) You can't change that... by gettin' all... bendy."
Wash: "All what?"
Jayne: "You got the... the light... from the console... keep you... lift you up. They shine like... (snatching at the air)... little... angels..." (falls over, unconscious) Wash: "Did he just go crazy and fall asleep?
Mal: "But she was naked! And... ...articulate!"
Sigh. Best. Show. Ever.
I have a ranty but I'm too tired to be coherent or fair. so maybe tomorrow. For now, Firefly.
Mal: If anyone gets nosy, just, you know, shoot 'em.
Zoe: Shoot 'em?
Mal: Politely.
Mal: See, this is a sign of your tragic space dementia. All paranoid and crotchety, it breaks the heart.
Mal: "This isn't happening." (to Saffron) "Will you stop crying?"
Inara: "Oh, for God's sake, Mal, can you be a human being for thirty seconds?"
Wash: "Speaking as one married man to another..."
Mal: "I am not married!" (to Saffron) "I'm sorry. You don't shame me, you have very nice qualities but I didn't ever marry you."
Book: (holding encyclopedia) "I believe you did. Last night." (Mal hesitates, steps toward Jayne
Mal: (to Jayne, quiet) "How drunk was I last night?"
Jayne: "I dunno, I passed out."
Zoe: Sir, I think you have a problem with your brain being missing.
Wash: "Don't fall asleep now. Sleepiness is weakness of character. Ask anyone! You're acting captain. Know what happens you fall asleep now?"
Zoe: "Jayne slits my throat and takes over."
Wash: "That's right."
Zoe: "And we can't stop it."
Wash: "Well, I wash my hands of it. It's a hopeless case. I'll read a nice poem at the funeral. Something with imagery."
Zoe: "You could lock the door and keep the power-hungry maniac at bay."
Wash: "Oh, no, I'm starting to like this poetry idea now. 'Here lies my beloved Zoe, my autumn flower, somewhat less attractive now she's all corpsified and gross'..."
Zoe: Planet's coming up a might fast.
Wash: Just means I'm going down too quick. Likely crash and kill us all.
Mal: That happens, let me know.
Mal: Define 'interesting.'
Wash: "Oh God, Oh God, we're all gonna die?"
Wash: You want a slinky dress? I can buy you a slinky dress. Captain, can I have money for a slinky dress?
Jayne: I'll chip in.
Zoe: I can hurt you.
Kaylee: These girls have the most beautiful dresses. And so do I, how 'bout that!
Mal: Well, careful with it. We cheated Badger outta good money to buy that frippery. You're supposed to make me look respectable.
Kaylee: Yes sir, Captain Tightpants.
Jayne: We need a di-version. I say Zoe gets nekkid.
Wash: Nope.
Jayne: I could get nekkid.
Simon/Zoe/Wash: No!
Badger: "Why ain't she talking? She's got a secret."
River: "Sure, I got a secret. More'n one. Don't seem likely I'd tell them t'you, now, do it? Anyone off Dyton Colony knows better'n t'talk t'strangers. You're talkin' loud enough for the both of us, though, en't'ya? I've known a dozen like you. Skipped off home early. Run graft jobs 'ere and there. Spent some time in the lockdown, but less'n you claim. Now you're what? Petty thief with illusions of standing? Sad little king of a sad little hill."
Badger: "...Nice to see someone from the old homestead."
River: "Not really." (to Simon) "Call me if anyone interesting shows up."
Badger: "I like her."
Jayne: "That right there? Exactly the kind of di-version we coulda used."
Mal: How can you say that? How can you shame me in front of new people?
Jayne: If I could make you prettier, I would.
Mal: You are not the man I met a year ago.
River: Noah's Ark is a problem.
Book: Really.
River: We'll have to call it early quantum state phenomenon. Only way to fit five thousand species of mammal on the same boat.
River: Also, I can kill you with my brain.
Mal: "And Kaylee, what the hell's goin' on in the engine room? Were there monkeys? Some terrifying space monkeys maybe got loose?"
Simon: My sister's a ship. We had a fairly complicated childhood.
Jayne: "Well, I say as a rule that girlfolk ain't to be trusted." River: "Jayne is a girl's name."
Mal: "I hate to bring up our imminent arrest during your crazy time, but we gotta move."
Zoe: "River, honey? He's putting the hair away now." River: "It'll still be there... waiting...."
Jayne Cobb: I once hit a guy in the neck from 500 yards with a bent scope. Don't that count upstairs?
Book: Oh, it'll be taken into consideration.
Jayne Cobb: You made that sound kinda ominous.
Jayne: "Anyone remember her coming at me with a butcher knife?"
Wash: "Wacky fun..."
Jayne: "You want to go, little man?"
Wash: "Only if it's someplace with candlelight."
Zoe: "Sir, I know she's unpredictable, but I don't think she'd harm anyone.
Jayne: "Butcher's knife?!"
Zoe: "Anyone we can't spare."
Inara: "Every well-bred petty crook knows -- the small concealable weapons always go to the far left of the place setting."
Mal: Try to see past what she is, on to what she can be.
Zoë: What's that, sir?
Mal: Freedom, is what.
Zoë: [pointing] No, I meant — what's that?
Mal: Oh. Just step around it. I think something must've been living in here.
Zoë: Get her running again?
Mal: Yeah.
Zoë: So...not running now?
Mal: Not so much.
Jayne: "You know what the chain of command is? It's the chain I go get and beat you with until you understand who's in ruttin' command here. (beat) You can't change that... by gettin' all... bendy."
Wash: "All what?"
Jayne: "You got the... the light... from the console... keep you... lift you up. They shine like... (snatching at the air)... little... angels..." (falls over, unconscious) Wash: "Did he just go crazy and fall asleep?
Mal: "But she was naked! And... ...articulate!"
Sigh. Best. Show. Ever.
Tuesday, April 14, 2009
With Apologies to Pliny the Elder.
Just shy of 50,000 dollars for a year at the Monterey Institute. I'd need 2.
well, fuck.
on the up side, even though Teh Intarwebs says you could have all manner of nasty, permanent, possibly-fatal diseases, it's vanishingly unlikely that you actually do, and the doctor will tell you that. Which is what I was expecting. Still. do I get points for creeping out the doctor? ("If that's what you expected...why did you come in?" "because murphy moves in mysterious ways." "...I'm sorry?" "murphy. Murphy's Law. Anything that can go wrong, will? or O'Toole's commentary on Murphy's Law? Murphy was an optimist?" "oh..kay?" "nevermind.") (she really should have been suspicious when I wrote on my drug history "ibuprofen/acetaminophen prn cramps/headache." the nursing assistant pointed to prn and asked me what that word was (yes I have scribbly writing SHUTUPdie). I said "prn. pro re nata. for the thing (which has been) born, or appeared...or less literally for the reason that appeared, or....(as I take in look of 'ohdeargod she's crazy')...um...per patient request." Yes, I said pretty much all that. it is NOT my fault, it was 0725 and I had NOT been allowed coffee AND I'd been awake since 0545.
I blame genetics. I'm betting bits of my DNA don't actually say GACTGACTATGCGCTATAATGC but ΓΑΧΤΓΑΧΤΑΤΓΧΓΧΤΑΤΑΑΤΓΧ.
well, fuck.
on the up side, even though Teh Intarwebs says you could have all manner of nasty, permanent, possibly-fatal diseases, it's vanishingly unlikely that you actually do, and the doctor will tell you that. Which is what I was expecting. Still. do I get points for creeping out the doctor? ("If that's what you expected...why did you come in?" "because murphy moves in mysterious ways." "...I'm sorry?" "murphy. Murphy's Law. Anything that can go wrong, will? or O'Toole's commentary on Murphy's Law? Murphy was an optimist?" "oh..kay?" "nevermind.") (she really should have been suspicious when I wrote on my drug history "ibuprofen/acetaminophen prn cramps/headache." the nursing assistant pointed to prn and asked me what that word was (yes I have scribbly writing SHUTUPdie). I said "prn. pro re nata. for the thing (which has been) born, or appeared...or less literally for the reason that appeared, or....(as I take in look of 'ohdeargod she's crazy')...um...per patient request." Yes, I said pretty much all that. it is NOT my fault, it was 0725 and I had NOT been allowed coffee AND I'd been awake since 0545.
I blame genetics. I'm betting bits of my DNA don't actually say GACTGACTATGCGCTATAATGC but ΓΑΧΤΓΑΧΤΑΤΓΧΓΧΤΑΤΑΑΤΓΧ.
Thursday, April 09, 2009
So Depressing.
These requirements are for a job that pays 3 to 6 dollars more than my current job.
Requirements: H.S. diploma. Familiarity with data entry, high attention to detail and accuracy, flexibility, and good communication skills are needed. Ability to follow laboratory protocols and access to a car are required. Previous experience in specimen handling is desirable.
whatdefmrgl. seriously.
Requirements: H.S. diploma. Familiarity with data entry, high attention to detail and accuracy, flexibility, and good communication skills are needed. Ability to follow laboratory protocols and access to a car are required. Previous experience in specimen handling is desirable.
whatdefmrgl. seriously.
Friday, April 03, 2009
three....darts....is....too...many....
caffeine, don't fail me now, baby.
Pumpkin Pie the First: done.
Pumpkin Pielet the Second: done. a bit too done. oh well. it's not really a pielet. it's just a little less...dense. yeah. that's it.
Margarita Pie the First: ...shush.
Margarita Pie the Second: ...uh...dependent on marit finding another can of sweetened condensed milk somewhere. this is not as big of a stretch as you might think.
what time is it? oh yeah....crap.
Am also supposed to finish up my last moleskine and go, but I need to sit down, stare at it, and repeat to myself "Marit. Perfectionism is BAD. It's fine. It's done. Remember Mrs Hess? Forcibly taking away your self portrait? Mrs Hess is, right now, at this very moment, twitching, and she doesn't know why. Put. The Sketchbook. Down." until I can shove it in an envelope.
what did we learn today, kids? Don't mention Iowa being more awesome than California to a Witness. (I mean...it's Iowa. ...not Luther, but Iowa. I-ow-a.)
Also, How To Make Someone's Eyes Go Boogley and Score One For Classical Dance: find a video on youtube of a professional male ballet dancer warming up with a rig on that shows muscle strain and forces. watch fellow EMT eyes go boogley and hear lots of "WTF is that?" "that's a quad." "that can't be a quad muscle. that's fucking huge." Yes, boys, tiny sissy little dancer-man can break you. in half. without breaking a sweat.
funfact? Adrian Paul is exactly 24 years older than I am. Yes, you're going to have to put up with more geekiness. this is what comes of being all post-migrane-fucked-up and watching a whole day of Highlander. I'm singing Queen to myself and making my partner look at me funny as I do parry drills waiting in hallways.
Pumpkin Pie the First: done.
Pumpkin Pielet the Second: done. a bit too done. oh well. it's not really a pielet. it's just a little less...dense. yeah. that's it.
Margarita Pie the First: ...shush.
Margarita Pie the Second: ...uh...dependent on marit finding another can of sweetened condensed milk somewhere. this is not as big of a stretch as you might think.
what time is it? oh yeah....crap.
Am also supposed to finish up my last moleskine and go, but I need to sit down, stare at it, and repeat to myself "Marit. Perfectionism is BAD. It's fine. It's done. Remember Mrs Hess? Forcibly taking away your self portrait? Mrs Hess is, right now, at this very moment, twitching, and she doesn't know why. Put. The Sketchbook. Down." until I can shove it in an envelope.
what did we learn today, kids? Don't mention Iowa being more awesome than California to a Witness. (I mean...it's Iowa. ...not Luther, but Iowa. I-ow-a.)
Also, How To Make Someone's Eyes Go Boogley and Score One For Classical Dance: find a video on youtube of a professional male ballet dancer warming up with a rig on that shows muscle strain and forces. watch fellow EMT eyes go boogley and hear lots of "WTF is that?" "that's a quad." "that can't be a quad muscle. that's fucking huge." Yes, boys, tiny sissy little dancer-man can break you. in half. without breaking a sweat.
funfact? Adrian Paul is exactly 24 years older than I am. Yes, you're going to have to put up with more geekiness. this is what comes of being all post-migrane-fucked-up and watching a whole day of Highlander. I'm singing Queen to myself and making my partner look at me funny as I do parry drills waiting in hallways.
Subscribe to:
Posts (Atom)
